monoclonal and bispecific antibodies, their antigen-binding fragments and binding protein for the tr

专利摘要:
antibodies for the treatment of infection and disease associated with clostridium difficile the present invention relates here reagents, compositions and therapies to treat infection with clostridium difficile and related disease conditions and conditions, such as diarrhea associated with clostridium difficile, which results in infection by the clostridium difficile bacteria and the enterotoxins produced by these bacteria. in particular, antibodies or antigen-binding fragments thereof that specifically bind toxin a and / or toxin b to c. difficile and neutralize the activities of these toxins; compositions comprising such antibodies; and methods of using antibodies and compositions are provided.
公开号:BR112012026021A2
申请号:R112012026021
申请日:2011-04-15
公开日:2020-04-14
发明作者:Cupo Albert；J Marozsan Andre；Kennedy Brian；Ma Dangshe；P Donovan Gerald；Nagashima Kirsten；Tsurushita Naoya；Kumar Shankar；C Olson William；Kang Yun
申请人:Progenics Pharm Inc；
IPC主号:

专利说明:

Invention Patent Descriptive Report for MONOCLONAL AND BIESPECIFIC ANTIBODIES, THEIR ANTIGEN-BINDING FRAGMENTS AND BINDING PROTEIN FOR THE TREATMENT OF INFECTION AND DISEASE ASSOCIATED WITH CLOSTRIDIUM DIFFICILE, AS WELL AS COMPOSITION, AGAINST AGRICULTURE NUCLEIC, PROCESS OF PRODUCTION OF THE ABOVE ANTIBODIES, KIT, EXPRESSION VECTOR, EX VIVO METHOD AND USES.
Related Patent Applications
This patent application claims priority under 35 USC §119 from US Provisional Patent Applications ^Nos 61/324503 s, filed on April 15, 2010 and 61/381669, filed on September 10, 2010, whose entire contents of each one is incorporated here for reference.
Field of the Invention
This invention relates generally to compositions and therapies that can be used to treat infection with Clostridium difficile (C. difficile) and disease conditions and pathologies associated with C. difficile, such as diarrhea associated with C. difficile (CDAD) , which can result from infection by C. difficile bacteria. The invention also relates to antibodies or fragments that bind to antigens thereof that specifically bind to epitopes on toxin A and / or toxin B of C. difficile, compositions comprising such antibodies, as well as methods of using the antibodies or compositions.
Background of the Invention
C. difficile (or C. diff.) Is an anaerobic gram-positive spore-forming bacterium that represents the main cause of nosocomial diarrhea (acquired in the hospital) associated with antibiotics and pseudomembranous oolitis. It is estimated that C. difficile infection totals more than 750,000 cases per year in the U.S. and is responsible for more deaths than all other combined intestinal infections (1). In many hospitals, C. difficile poses a greater risk to patients than methicillin-resistant Staphylococcus aureus (MRSA) or any other bacteria (2). Annual costs
The following sheet 1 to / 183 to / 183 for the control of disease associated with Clostridium difficile (CDAD) is estimated to exceed $ 3.2 billion in the U.S. (3). Recent outbreaks of C. difficile strains with greater virulence or resistance to antibiotics have led to treatment failures, more frequent relapses and
Following is sheet 2/183
2/183
CDAD is typically induced by disturbance of colonic flora through the use of antibiotics such as clindamycin, cephalosporins and fluoroquinolones. (3,8) This disturbance in the colonic microenvironment, together with exposure to C. difficile spores, leads to colonization. Approximately one third of all patients who become colonized develop CDAD (9), which can result in severe diarrhea, colon perforation, colectomy and death (10). CDAD results after the acquisition and proliferation of C. difficile in the intestines, where C. difficile bacteria produce toxin A and toxin B, two important virulence factors of CDAD. C. difficile toxins A and B exhibit considerable structural and sequence homology. Both have a C-terminal receptor binding domain containing several repeat sequences, a central hydrophobic domain and an N-terminal glucosyltransferase domain. The receptor-binding domain mediates the binding of toxins to intestinal epithelial cells through host receptors that remain poorly defined in humans. After internalization through the endosomal pathway, the central hydrophobic domain is inserted within the membrane of the endosome. The acidic pH of the endosome activates the formation of pores and the translocation of the amino-terminal domains of the toxins into the cytosol. The glycosylation of the cytosolic target Rho GTPases leads to disruption of the cytoskeleton and cell death. Toxins A and B demonstrate different pathological profiles with potential synergy in the cause of the disease.
Recent outbreaks of a hypervirulent C. difficile strain have resulted in higher rates of severe illness, more frequent relapses and higher mortality. A hypervirulent strain, BI / NAP1 / 027 type of toxin III, was historically uncommon, but is now epidemic. Hypervirulent strains, such as B1 / NAP1 / 027, produce several times more toxin A and toxin B than non-hypervirulent strains of C. difficile, making such strains more formidable to treat immediate infection. Since the resistance of hypervirulent strains to commonly used antimicrobials and antibiotics is a growing problem that makes these strains more difficult to treat and contain, additional treatment approaches and more potent therapies are needed.
3/183 salaries to combat hypervirulence and disease recurrence that are associated with hypervirulent C. difficile isolates.
Current antibiotic treatments for C. difficile infection include the use of vancomycin and / or metronidazole; however, 5 these antibiotics are limited by incomplete response rates and increasing rates of reinfection and recurrence. Since 2000, substantially higher failure rates have been reported for metronidazole therapy (23-25). The high rates of recurrence after antibiotic treatment can result from the continued interruption of normal colonic flora, providing C.
difficile the opportunity to recover with little competition. (26-28) The risk of recurrence is greater in patients who have already had a recurrence, occurring from approximately 20% after an initial episode to more than 60% after two or more recurrences. (29,30) This increased risk of recurrence was associated with failure to mount a suitable an15 titoxin antibody response. (31) In fact, patients with the highest serum IgG antitoxin titers at the end of antimicrobial therapy had a lower risk of recurrence. (32) In a separate study, serum levels of anti-toxin B were correlated with protection of recurrent CDAD. (33)
The prevalence of C. difficile infection has steadily increased, particularly in the elderly, who are often fragile. Approximately one third of patients with infection caused by
C. difficile has recurrences of its infection, usually within two months of the initial disease. Repeated infections tend to be more severe than the original disease; these are most often fatal. Older adults and people with weakened immune systems are particularly susceptible to recurrent infections. If not treated promptly and appropriately, complications from C. difficile infection include dehydration, kidney failure, intestinal perforation, toxic megacolon, 30 which can lead to colon rupture and death.
Although in the United States of America, infection caused by
C. difficile is the most common infection acquired by hospitalized patients
4/183 of, it can also be acquired outside of hospitals in the community. It is estimated that 20,000 infections with C. difficile occur in the community each year in the United States of America. Internationally, the incidence is highly variable and depends on several factors, including the frequency with which endoscopy is used to establish the diagnosis, patterns of use of antimicrobial agents and epidemiological patterns.
Thus, it is evident that the disease caused by the infection caused by C. difficile puts the lives of people of all ages at risk, both in nosocomial units and in the community in general. In today's world, there is an ever-present risk of infection caused by C. difficile for those facing hospitalization or who are in long-term hospital care. Due to the fact that there is still a chance of getting C. difficile infection outside of a hospital setting, the possibility for young children and babies to contract the disease is enormous. In addition, there is a potential that current antibiotic regimens used to treat
C. difficile may be less than optimally efficient. Patients who have a disease associated with C. difficile require extensive inpatient care and a long stay in the hospital. The costs associated with the high degree of supportive care in the hospital and the necessary treatment for patients with diseases associated with C. difficile are large and involve expensive resources, such as greater numbers of teams of doctors and nurses, laboratory tests and monitoring, concomitant medications and additional supportive measures.
Consequently, there is a need for more efficient medications, drugs and treatments that target life-threatening diseases caused by C. difficile, and in particular the potent toxins that are produced by C. difficile, for prophylactic and therapeutic benefit. There is an unmet need for successful and long-lasting treatments for the disease associated with C. difficile that offer less potential for the development of resistance and greater potential for successful patient response and resolution of the disease, leading to the eradication of the disease.
5/183
Summary of the Invention
The invention provides, at least in part, new antibody reagents and compositions comprising C. difficile anti-toxin A and / or anti-toxin B antibodies. Reagents and compositions can be beneficial in treating the increasingly prevalent numbers of individuals affected with C. difficile infection and disease, providing better quality of life, resolving CDAD and C. difficile infection and aiding the survival of these infected individuals .
In one aspect, an isolated antibody or antigen-binding fragment thereof, which specifically binds to C. difficile toxin A and which cross-competes for binding with C. difficile toxin A with a monoclonal antibody produced by a hybridoma cell line deposited under ATCC Accession No. PTA-9692, PTA-9694 or PTA-9888 is provided. In one embodiment, the hybridoma cell line is deposited under ATCC Accession No. PTA-9692. In one embodiment, the hybridoma cell line is deposited under ATCC Accession No. PTA-9694. In one embodiment, the hybridoma cell line is deposited under ATCC Accession No. PTA-9888. In one embodiment, the monoclonal antibody or the antigen-binding fragment thereof is in chimeric or humanized form.
In another aspect, an isolated antibody or antigen-binding fragment thereof that specifically binds to an C. difficile toxin A epitope defined by a monoclonal antibody produced by the hybridoma cell line deposited under the Accession No. of the ATCC PTA-9692, PTA-9694 or PTA-9888 is provided. In one embodiment, the hybridoma cell line is deposited under ATCC Accession No. PTA-9692. In one embodiment, the hybridoma cell line is deposited under ATCC Accession No. PTA-9694. In one embodiment, the hybridoma cell line is deposited under ATCC Accession No. PTA-9888. In one embodiment, the monoclonal antibody or the antigen-binding fragment thereof is in chimeric or humanized form.
In another aspect, an isolated antibody or a fragment of
6/183 the antigen, which specifically binds to C. difficile toxin B and cross-competes for binding to C. difficile toxin B from a monoclonal antibody produced by the hybridoma cell line deposited under No ATCC Access Code PTA-9693 or PTA-9692 is provided. In one embodiment, the hybridoma cell line is deposited under ATCC Accession No. PTA-9693. In one embodiment, the hybridoma cell line is deposited under ATCC Accession No. PTA-9692. In one embodiment, the monoclonal antibody or the antigen-binding fragment thereof is in chimeric or humanized form.
In another aspect, an isolated antibody or antigen-binding fragment thereof that specifically binds to an C. difficile toxin B epitope defined by a monoclonal antibody produced by the hybridoma cell line deposited under the Accession No. of the ATCC PTA-9693 or PTA-9692 is provided. In one embodiment, the hybridoma cell line is deposited under ATCC Accession No. PTA-9693. In one embodiment, the hybridoma cell line is deposited under ATCC Accession No. PTA-9692. In one embodiment, the monoclonal antibody or the antigen-binding fragment thereof is in chimeric or humanized form. In one embodiment, the isolated antibody or antigen-binding fragment of the same neutralizes the in vivo toxicity of C. difficile toxin B. In one embodiment, the antibody or antigen-binding fragment of the same neutralizes the in vivo toxicity of C. difficile toxin B in an amount of 0.1-1000 pg.
In another aspect, the monoclonal antibody PA-39 (ATCC Accession No. 9692) or an antigen-binding fragment thereof is provided. In another aspect, monoclonal antibody PA-50 (ATCC Accession No. PTA-9694) or an antigen-binding fragment thereof is provided. In another aspect, monoclonal antibody PA-38 (ATCC Accession No. PTA-9888) or an antigen-binding fragment thereof is provided. In another aspect, monoclonal antibody PA-41 (ATCC Accession No. PTA-9693) or an antigen-binding fragment thereof is provided. In one embodiment, the monoclonal antibody or the fragment of li
7/183 the antigen, is in chimeric or humanized form.
In yet another aspect, an expression vector comprising at least one nucleic acid molecule that encodes the antibodies or fragments that bind to antigens thereof as described above and is provided herein. In yet another aspect, an expression vector comprising a nucleic acid molecule encoding the heavy chain or a portion thereof of the antibodies or fragments that bind to antigens thereof as described above or is provided herein. In yet another aspect, an expression vector comprising a nucleic acid molecule encoding the light chain or a part thereof, the antibodies or fragments that bind to antigens thereof as described above or is provided herein. In yet another additional aspect an expression vector comprising at least one nucleic acid molecule encoding the heavy chain or a portion thereof and the light chain or portion thereof, the antibodies or antigen-binding fragments thereof as described previously or is provided here.
In another aspect, a host cell transformed or transfected by any of the expression vectors described above and provided herein. In another aspect, a plasmid encoding any of the antibodies or antigen-binding fragments thereof as described above and is provided herein.
In another aspect an isolated C. difficile antitoxin A antibody or antigen-binding fragment is provided as described above and here, wherein the antibody or antigen-binding fragment neutralizes the in vivo toxicity of C. difficile toxin A . In one embodiment, the antibody or antigen binding fragment neutralizes the in vivo toxicity of C. difficile toxin A in an amount of 0.1 pg up to 1000 pg or 1 pg / kg up to 100,000 pg / kg. In another embodiment, the isolated antibody or antigen-binding fragment neutralizes the in vivo toxicity of C. difficile toxin A in a selected amount of 0.5 pg-1000 pg or 5 pg-250 pg or 10 mg / kg-50 mg / kg. In one embodiment, the antibody is the
8/183 monoclonal antibody PA-39 (ATCC Accession No. 9692) or an antigen-binding fragment thereof. In one embodiment, the antibody is the PA-50 monoclonal antibody (ATCC Accession No. PTA-9694) or an antigen-binding fragment thereof. In one embodiment, the antibody is the monoclonal antibody PA-38 (ATCC Accession No. PTA-9888) or an antigen-binding fragment thereof. In one embodiment, the monoclonal antibody or antigen-binding fragment thereof is in chimeric or humanized form.
In another aspect, an isolated C. difficile B antitoxin B antibody or antigen binding fragment is provided as described above and here, wherein the antibody or antigen binding fragment neutralizes the in vivo toxicity of C. difficile B toxin . In one embodiment, the isolated antibody or antigen-binding fragment of it neutralizes the in vivo toxicity of C. difficile toxin B in a selected amount of 0.5 pg-1000 pg, 0.5 pg, 5 pg, 40 pg, 50 pg, 100 pg, 200 pg, 1000 pg or 10 mg / kg-50 mg / kg. In one embodiment, the antibody is the monoclonal antibody PA-39 (ATCC Accession No. 9692) or an antigen-binding fragment thereof. In one embodiment, the antibody is the monoclonal antibody PA-41 (ATCC Accession No. PTA-9693) or an antigen-binding fragment thereof. In one embodiment, the monoclonal antibody or antigen-binding fragment thereof is in chimeric or humanized form.
Another aspect provides an isolated C. difficile antitoxin A antibody or antigen-binding fragment as described above and here, wherein the antibody or antigen-binding fragment, when administered to a C. difficile-infected individual in combination with an isolated antibody or antigen-binding fragment thereof that specifically binds and / or neutralizes C. difficile toxin B, treats CDAD and / or increases the individual's ability to survive. In one embodiment, the anti-toxin A and anti-toxin B antibodies or fragments thereof are administered simultaneously. In one embodiment, anti-toxin A and anti-toxin B antibodies or fragments thereof are admissible
9/183 at different times. In one embodiment, anti-toxin A and anti-toxin B antibodies or fragments thereof are administered sequentially. In one embodiment, the isolated antibody or antigen-binding fragment that specifically binds to C. difficile toxin A is an antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9692, PTA- 9694 or PTA-9888, an antigen-binding fragment thereof, a humanized form of the same or a monoclonal antibody that cross-reacts with it by binding to toxin A. In one embodiment, the isolated antibody or the binding fragment to the antigen that specifically binds C. difficile toxin B is an antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9693 or PTA-9692, a fragment of antigen binding thereof, a form humanized protein or a monoclonal antibody that cross-reacts with it by binding to toxin B.
Another aspect provides an isolated C. difficile antitoxin B antibody or antigen-binding fragment as described above and here, wherein the antibody or antigen-binding fragment, when administered to a C. difficile-infected individual in combination with an isolated antibody or antigen-binding fragment thereof that specifically binds and / or neutralizes C. difficile toxin A, treats CDAD and / or increases the individual's ability to survive. In one embodiment, anti-toxin A and anti-toxin B antibodies or fragments thereof are administered simultaneously. In one embodiment, anti-toxin A and anti-toxin B antibodies or fragments thereof are administered at different times. In one embodiment, anti-toxin A and anti-toxin B antibodies or fragments thereof are administered sequentially. In one embodiment, the isolated antibody or antigen-binding fragment that specifically binds C. difficile toxin A is an antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9692, PTA-9694 or PTA-9888, a fragment that binds to its antigen, a humanized form of
10/183 same or a monoclonal antibody that cross-reacts with it by binding to toxin A. In one embodiment, the isolated antibody or antigen-binding fragment that specifically binds C. difficile toxin B is an antibody produced by the hybridoma cell lineage deposited under ATCC Accession No. PTA-9693 or PTA-9692, an antigen-binding fragment, a humanized form of it or a monoclonal antibody that cross-reacts with it by binding to toxin B.
Another aspect provides an isolated C. difficile antitoxin A antibody or antigen-binding fragment as described above and here, wherein the antibody or antigen-binding fragment, when administered to an individual infected with C. difficile in combination with an isolated antibody or antigen-binding fragment thereof that specifically binds C. difficile toxin B, treats CDAD and / or improves the individual's ability to survive. In one embodiment, the antitoxin A antibody or antigen-binding fragment thereof is administered in an amount of 1 pg-1000 pg or 1 pg-250 pg or 5 pg-100 pg and the dose of the antitoxin B antibody or fragment binding to the antigen thereof is administered in an amount of 0.1 pg-1000 pg or 1 pg-250 pg or 5 pg-100 pg. In one embodiment, the isolated antibody or antigen-binding fragment that specifically binds to C. difficile toxin A is an antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9692, PTA- 9694 or PTA-9888, a fragment of binding to the antigen of it, a humanized form of the same or a monoclonal antibody that cross-reacts with it by binding to toxin A. In one embodiment, the isolated antibody or the binding fragment The antigen that specifically binds to C. difficile B toxin is an antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9693 or PTA-9692, a fragment of antigen binding thereof, a humanized form of it or a monoclonal antibody that cross-reacts with it by binding to toxin B.
11/183
Another aspect provides an isolated C. difficile antitoxin A antibody or antigen-binding fragment as described above and here, wherein the antibody or antigen-binding fragment, when administered to an individual infected with C. difficile in combination with an isolated antibody or antigen-binding fragment thereof that specifically binds to C. difficile toxin B, treats CDAD and / or improves the individual's ability to survive. In one embodiment, the anti-toxin A antibody or antigen-binding fragment of the same is administered in an amount of 50 mg / kg, the anti-toxin B antibody or the antigen-binding fragment of the same is administered in an amount of 50 mg / kg. kg. In one embodiment, the isolated antibody or antigen-binding fragment that specifically binds to C. difficile toxin A is an antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9692, PTA- 9694 or PTA-9888, a fragment of binding to the antigen of it, a humanized form of the same or a monoclonal antibody that cross-reacts with it by binding to toxin A. In one embodiment, the isolated antibody or the binding fragment The antigen that specifically binds to C. difficile B toxin is an antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9693 or PTA-9692, a fragment of antigen binding thereof, a humanized form of it or a monoclonal antibody that cross-reacts with it by binding to toxin B.
Another aspect provides an isolated C. difficile antitoxin A antibody or antigen-binding fragment as described above and here, wherein the antibody or antigen-binding fragment, when administered to an individual infected with C. difficile in combination with an isolated antibody or antigen-binding fragment that specifically binds to C. difficile toxin B, has a cure or survivability rate of 50%, 60%, 70%, 80%, 90% or 100%. In one embodiment, the antibody or antigen-binding fragment is administered q2d x 4 at a dose of 40-50 mg / kg. In a modali
12/183, the isolated antibody or antigen-binding fragment that specifically binds to C. difficile toxin A is an antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9692, PTA -9694 or PTA-9888, a fragment of antigen binding thereof, a humanized form of it or a monoclonal antibody that cross-competes for binding to toxin A with one or more of the monoclonal antibodies deposited under the Accession No. ATCC PTA-9692, PTA-9694 or PTA-9888. In one embodiment, the isolated antibody or antigen-binding fragment that specifically binds to C. difficile toxin B is an antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9693 or PTA- 9692, an antigen-binding fragment thereof, a humanized form of it, or a monoclonal antibody that cross-competes for binding to toxin B with one or more of the monoclonal antibodies deposited under ATCC Accession No. PTA-9692 or PTA-9693.
In another aspect, an isolated C. difficile antitoxin A or C. difficile antitoxin B antibody or an antigen-binding fragment thereof as described herein is provided, wherein the antibody or antigen-binding fragment is, is in the form from or is derived from, one or more of a monoclonal antibody, a humanized antibody, a human antibody or a chimeric antibody.
In another aspect, an isolated C. difficile antitoxin A or C: difficile antitoxin B antibody or an antigen-binding fragment thereof as described herein is provided, wherein the antibody or antigen-binding fragment thereof is, is in the form of or is comprised of, a bispecific or bifunctional antibody.
Another aspect provides a bispecific antibody or antigen-binding fragment thereof comprising (i) a monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9692, PTA-9694 or PTA-9888 , an antigen-binding fragment thereof, a humanized version of the antibody or the antigen-binding fragment, a vari domain
13/183 heavy chain link of the antibody or antigen binding fragment thereof and / or a light chain variable domain of the antibody or antigen binding fragment thereof; and (ii) a monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9693 or PTA-9692, an antigen binding fragment thereof, a humanized version of the antibody or binding fragment to the antigen thereof, a heavy chain variable domain of the antibody or antigen binding fragment thereof and / or a light chain variable domain of the antibody or antigen binding fragment thereof.
Another aspect provides a bispecific antibody or antigen-binding fragment thereof, wherein the antibody comprises (i) a monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9692, a fragment of antigen-binding it, a humanized version of the antibody or antigen-binding fragment thereof, an antibody heavy chain variable domain or antigen-binding fragment thereof and / or a light chain variable domain of the antibody or the antigen-binding fragment thereof; and (ii) an isolated monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9693 or PTA-9692, an antigen-binding fragment thereof, a humanized version of the antibody or fragment of antigen binding, a heavy chain variable domain of the antibody or antigen binding fragment thereof and / or a light chain variable domain of the antibody or antigen binding fragment thereof.
In various embodiments, an antibody or antigen-binding fragment thereof as described above and here, wherein the antigen-binding fragment is selected from a Fab fragment, an F (ab ') 2 fragment and an Fv fragment is provided. In another aspect an isolated antibody or antigen-binding fragment thereof as described above and here, wherein the antibody or the binding fragment
14/183 to the antigen thereof is or comprises an isolated chain antibody is provided.
In another aspect a composition comprising one or more of the antibodies or fragments that bind to antigens thereof, as described above and herein and a pharmaceutically acceptable carrier, excipient, vehicle or diluent is provided. In one embodiment, the composition comprises at least one antitoxin A antibody of the invention, for example, mAb PTA-9692, mAb PTA-9694, mAb PTA-9888, an antigen binding fragment thereof or a humanized form thereof and at at least one antitoxin B antibody of the invention, for example, mAb PTA-9692, mAb PTA-9693, an antigen-binding fragment thereof or a humanized form thereof. In one embodiment, the composition comprises an anti-toxin A antibody of the invention, for example, mAb PTA-9888, an antigen-binding fragment thereof or a humanized form of the same and an anti-toxin B antibody of the invention, for example, mAb 9693, a fragment of binding to the antigen of it or a humanized form of it. In one embodiment, the composition comprises an anti-toxin A antibody of the invention, for example, mAb PTA-9694, an antigen-binding fragment thereof or a humanized form of the same and an anti-toxin B antibody of the invention, for example, mAb 9693, a fragment of binding to the antigen of it or a humanized form of it. In one embodiment, each mAb is present in the composition in the same amount. In one embodiment, each mAb is present in the composition in a proportion of 1: 1, by weight, in relation to each other. In one embodiment, each mAb is present in the composition in different amounts. In one embodiment, each mAb is present in the composition in proportions other than 1: 1, by weight, relative to each other, where the proportions are as provided here. In one embodiment, the composition further comprises an additional therapeutic agent. In one embodiment, the additional therapeutic agent is an antibiotic, antibacterial, bacteriocidal, bacteriostatic agent or a combination thereof. In one embodiment, the additional therapeutic agent is metronizadol, vanco15 / 183 mycine, fidaxomycin or a combination thereof.
In another aspect a composition comprising an expression vector of the invention, as described above and here and a pharmaceutically acceptable carrier, excipient, vehicle or diluent 5 is provided. In another aspect a composition comprising a host cell that carries an expression vector of the invention, as described above and herein and a pharmaceutically acceptable carrier, excipient, vehicle or diluent is provided. In another aspect a composition comprising a plasmid of the invention, as described above and herein and a pharmaceutically acceptable carrier, excipient, vehicle or diluent is provided.
Another aspect provides a binding protein that comprises at least two polypeptide chains that comprise binding sites for binding to C. difficile toxin A and toxin B, wherein at least one polypeptide chain comprises a first heavy chain variable domain, a second heavy chain variable domain and a heavy chain constant domain or a portion thereof; and at least one polypeptide chain comprises a first light chain variable domain, a second light chain variable domain, and a light chain constant domain a portion thereof, wherein the variable domains comprising the polypeptide chains form functional binding sites for toxin A and C. difficile toxin B. In one embodiment, the first heavy chain variable domain and the first light chain variable domain of the binding protein form a functional binding site for 25 C. difficile toxin and the second heavy chain variable domain and the second variable domain light-chain binding proteins form a functional binding site for C. difficile toxin B. In one embodiment, the first heavy chain variable domain and the first light chain variable domain of the binding protein form a functional binding site for C. difficile toxin 30 B and the second heavy chain variable domain and the second variable domain light-chain binding proteins form a functional binding site for C. difficile toxin A. In one embodiment, the protein
16/183 in the linkage comprises an Fc region. In one embodiment, the binding protein neutralizes the toxicity of toxin A and toxin B of C. difficile. In several embodiments, the binding protein has a velocity constant on (Kon) to toxin A or selected toxin B of at least 10 ² M ' ¹ s'¹; at least 10 ³ M ' ¹ s'¹; at least 10 ⁴ M ' ¹ s'¹; at least 10 ⁵ M ' ¹ s'¹; at least 10 ⁶ M ' ¹ s'¹; or at least 10 ⁷ M ' ¹ s' ¹ , which is measured by surface plasmon resonance. In several embodiments, the binding protein has an off-rate constant (Koff) to toxin A or selected toxin B of a maximum of 10 ' ³ s'¹; at most ΙΟΥ; maximum 10 ' ⁵ s'¹; or at most 10¾ ¹ . which is measured by surface plasmon resonance. In several embodiments, the binding protein has a dissociation constant (K _D ) to toxin A or selected toxin B of a maximum of 10 ⁷ M; maximum 10 ' ⁸ M; maximum 10 ' ⁹ M; maximum 10 ' ¹ ° M; maximum 10 ^'11 M; maximum IO ^'12 M; or at most ^10'13 M.
In another aspect a composition comprising the binding protein as described above and herein and a pharmaceutically acceptable carrier, excipient, vehicle or diluent is provided. In one embodiment, the composition further comprises an additional therapeutic agent. In one embodiment, the additional therapeutic agent in the composition is an antibiotic, antibacterial, bacteriocidal, bacteriostatic agent or combination thereof. In one embodiment, the additional therapeutic agent in the composition is metronizadol, vancomycin, fidaxomycin, nitazoxanide, rifaximin ramosplanin or a combination thereof.
In another aspect the hybridoma cell line deposited under ATCC Accession No. PTA-9692, PTA-9693, PTA-9494 or PTA-9888 is provided.
Another aspect provides a method of treating an individual with C. difficile infection or a disease associated with C. difficile, which comprises administering to the individual at least one composition as described herein. In one embodiment the compositions include one or more of the antibodies of the invention, preferably in humanized form. In one embodiment the compositions contain at least one antibody
17/183 antitoxin A provided here in humanized form or a fragment of binding to the antigen thereof and at least one antitoxin B antibody of the invention in humanized form or a fragment of binding to the antigen thereof. In various embodiments, one or more additional therapeutic reagents, drugs, compounds or ingredients can be included in the compositions. In one embodiment, the compositions further include a carrier, a diluent, a vehicle or a pharmaceutically acceptable excipient. In one embodiment, the compositions are administered in an effective amount to treat infection caused by C. difficile or disease associated with C. difficile, for example, diarrhea associated with C. difficile (CDAD). In one embodiment, two compositions are administered to the individual in an amount effective to treat infection caused by C. difficile or the disease associated with C. difficile. In one embodiment, the two compositions are administered at the same time. In one embodiment, the two compositions 15 are administered at different times.
Another aspect provides a method of inhibiting or neutralizing toxicity to a cell by toxin A and toxin B C. difficile, which comprises subjecting the cell to an efficient dose or inhibition of C. difficile toxin A of an anti-toxin monoclonal antibody The one of the invention or an antigen-binding fragment thereof and an efficient dose or inhibition of C. difficile toxin B of an anti-toxin B monoclonal antibody of the invention or an antigen-binding fragment thereof. In one embodiment, the anti-toxin A antibody and the anti-toxin B antibody are in humanized form. In one embodiment, the anti-toxin A antibody and the anti-toxin B antibody are in chimeric form. In one embodiment, antibodies or fragments that bind to antigens are administered at the same time. In one embodiment, antibodies or fragments that bind to antigens are administered at different times. In one embodiment of the method, the cell is present in an individual and the antibodies or fragments that bind to antigens are administered to the individual in an amount effective to inhibit or neutralize toxin A and toxin B of C.
18/183 difficile.
Another aspect provides a method of inhibiting or neutralizing the toxicity of a cell by a C. difficile toxin which comprises subjecting the cell to an efficient inhibiting or neutralizing dose of C. difficile toxin from at least one of the compositions of the invention as described here. In one embodiment of the method, the cell is subjected to an efficient dose or inhibition of C. difficile toxin from two compositions, one of which comprises an antitoxin A antibody or an antigen-binding fragment thereof and one of which comprises 10 an antitoxin B antibody or an antigen-binding fragment thereof. In one embodiment, antibodies are humanized. In one embodiment, the antibodies are chimeric. In modalities, the two compositions are administered at the same time or at different times. In one embodiment, the cell is present in an individual and at least one composition is administered to the individual in an amount effective to inhibit or neutralize the C. difficile toxin.
Another aspect provides a method of neutralizing toxins produced by a hypervirulent strain of C. difficile, which comprises administering to an individual who needs (i) an antibody 20 or an antigen-binding fragment of the same invention, in that the antibody binds and neutralizes C. difficile toxin A and (ii) an antibody or antigen-binding fragment of the same invention, in which the antibody binds and neutralizes C. difficile toxin B, in a effective amount to neutralize the toxins produced by the hypervirulent strain. In one embodiment, the antibodies of (i) and (ii) are humanized antibodies. In one embodiment, the antibodies of (i) and (ii) are chimeric antibodies. In modalities, antibodies or fragments that bind to antigens are administered at the same time or at different times. In one embodiment, the toxins of the hypervirulent strain are toxin A and toxin 30 B. In one embodiment, the hypervirulent strain of C. difficile is one or more of BI / NAP1 / 027, CCL676, HMC553, Pitt45, CD196, montreal 5 or montreal 7.1. In one embodiment, the antitoxin A antibody or the binding fragment
19/183 the antigen has a neutralizing activity against toxin A produced by the hypervirulent strains of C. difficile which is determined by an EC ₅₀ value of 2.6 ^'12 M to 7.7' ¹¹ M or 7 , 7 ¹² M to 4.8 ' ⁸ M. In one embodiment, the antitoxin B antibody or antigen-binding fragment thereof has a neutralizing activity against toxin B u / produced by the hypervirulent strains of C. difficile that is determined by an EC ₅₀ value of 1, T ¹¹ M to 6.5 ^'10 M.
In another aspect a kit comprising an antibody or antigen-binding fragment thereof and as described herein, particularly in the humanized form and instructions for use is provided. In one embodiment, the antibodies or fragments that bind to antigens are contained in the same container in the kit. In one embodiment, the antibodies or fragments that bind to antigens are contained in separate containers in the kit. In one embodiment, the kit comprises a ligand for conjugating the antibodies or fragments that bind to antigens on them. In one embodiment, the kit comprises an additional therapeutic agent, which can be an antibiotic, antibacterial, bacteriocidal or bacteriostatic agent. In one embodiment, the additional therapeutic agent is metronizadol, vancomycin, fidaxomycin, nitazoxanide, rifaximin 20 ramosplanin or a combination thereof.
In another aspect, a monoclonal antibody or antigen-binding fragment thereof, particularly in humanized form, which neutralizes toxin A or toxin B from a hypervirulent strain of C. difficile is provided. In one embodiment, the monoclonal antibody is designated by the ATCC Accession number PTA-9692, PTA-9694, PTA-9888 or PTA-9693 and is produced by a hybridoma cell line deposited under the ATCC Accession No. PTA -9692, PTA-9694, PTA-9888 or PTA-9693, respectively. In one embodiment, the antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9692, 30 PTA-9694, PTA-9888, PTA-9693 or PTA-9692 has been humanized or is in chimeric form. In one embodiment, the C. difficile hypervirulent strain is one or more of BI / NAP1 / 027, CCL676, HMC553, Pitt45, CD196, montreal 5
20/183 and montreal 7.1.
In another aspect, a method of treating an individual who is asymptomatic, but who is susceptible to or at risk of contracting infection caused by C. difficile, which comprises: administering to the individual 5 ^v of (i) an anti-toxin A antibody of C. difficile or a fragment of binding to _: antigen of the same supplied and as described here and (ii) an antitoxin B antibody of C. difficile or a fragment of antigen binding of the same provided and as described here, in an efficient amount to treat the individual is provided. In a method modality, the individual is hospitalized10.
In another aspect, a humanized monoclonal antibody generated against C. difficile toxin A is provided. In one embodiment, such C. difficile antitoxin A antibody is composed of two heavy chain polypeptides, each heavy chain containing a VH region that comprises the amino acid sequence shown in SEQ ID NO: 1 and a CH region human and two heavy chain polypeptides, each light chain containing a VL region comprising the amino acid sequence that is shown in SEQ ID NO: 3 and a human CL region. In one embodiment, such C. difficile antitoxin A antibody is composed of two two heavy chain polypeptides, each heavy chain containing a VH region comprising the amino acid sequence that is shown in SEQ ID NO: 2 and a CH region human and two heavy chain polypeptides, each light chain containing a VL region comprising the amino acid sequence that is shown in SEQ ID NO: 3 and 25 a human CL region. In one embodiment, such C. difficile antitoxin A antibody is composed of two heavy chain polypeptides, each heavy chain containing a VH region comprising the amino acid sequence that is shown in SEQ ID NO: 1 and a human CH region and two heavy chain polypeptides, each light chain containing a VL region comprising the amino acid sequence that is shown in SEQ ID NO: 4 and a human CL region. In one embodiment, such C. difficile antitoxin A antibody is composed of two chain polypeptides
21/183 heavy, where each heavy chain contains a VH region comprising the amino acid sequence that is shown in SEQ ID NO: 2 and a human CH region and two heavy chain polypeptides, where each light chain contains a VL region comprising the a5 minoacid sequence shown in SEQ ID NO: 4 and a human CL region.
In one embodiment, such C. difficile antitoxin A antibody is composed of two heavy chain polypeptides, each heavy chain containing a VH region comprising the amino acid sequence that is shown in SEQ ID NO: 5 and a human CH region and two heavy chain polypeptides, each light chain containing a VL region comprising the amino acid sequence that is shown in SEQ ID NO: 7 and a human CL region. In one embodiment, such C. difficile antitoxin A antibody is composed of two heavy chain polypeptides, each heavy chain containing a VH region comprising the a15 minoacid sequence shown in SEQ ID NO: 6 and a CH region human and two heavy chain polypeptides, each light chain containing a VL region comprising the amino acid sequence that is shown in SEQ ID NO: 7 and a human CL region.
In another aspect a humanized monoclonal antibody generated against C. difficile toxin B is provided. In one embodiment, such C. difficile antitoxin B antibody is composed of two heavy chain polypeptides, each heavy chain containing a VH region comprising the amino acid sequence that is shown in SEQ ID NO: 8 and a human CH region and two heavy chain polypeptides, wherein ca25 of the light chain contains a VL region comprising the amino acid sequence that is shown in SEQ ID NO: 10 and a human CL region. In one embodiment, such C. difficile antitoxin B antibody is composed of two heavy chain polypeptides, each heavy chain containing a VH region comprising the amino acid sequence that is shown in SEQ ID NO: 9 and a CH region human and two heavy chain polypeptides, each light chain containing a VL region comprising the amino acid sequence that is shown in SEQ ID NO: 10
22/183 and a human CL region.
In another aspect, a monoclonal antibody or a fragment thereof, generated against toxin A of C. difficile, in which the antibody is composed of two heavy chain polypeptides, each heavy chain containing a VH region and a human CH region and two polypeptides heavy chain, each light chain containing a human VL region and a human CL region is provided. The nucleic acid sequence (or cDNA) encoding the amino acid sequence of the heavy chain antibody polypeptide of SEQ ID NO: 14 is shown in SEQ ID NO: 15 (Fig. 38B); the nucleic acid sequence (or cDNA) encoding the amino acid sequence of the light chain antibody polypeptide of SEQ ID NO: 16 is shown in SEQ ID NO: 17 (Fig. 38A).
In another aspect, a monoclonal antibody or a fragment thereof, generated against toxin A of C. difficile, in which the antibody is composed of two heavy chain polypeptides, each heavy chain containing a VH region and a human CH region and two polypeptides heavy chain, each light chain containing a human VL region and a human CL region is provided. The nucleic acid sequence (or cDNA) encoding the amino acid sequence of the heavy chain antibody polypeptide of SEQ ID NO: 18 is shown in SEQ ID NO: 19 (Fig. 39B); the nucleic acid sequence (or cDNA) encoding the amino acid sequence of the light chain antibody polypeptide of SEQ ID NO: 20 is shown in SEQ ID NO: 21 (Fig. 39A).
In another aspect, a monoclonal antibody or a fragment thereof, generated against C. difficile toxin B, in which the antibody is composed of two heavy chain polypeptides, each heavy chain containing a VH region and a human CH region and two polypeptides heavy chain, each light chain containing a human VL region and a human CL region is provided. The nucleic acid sequence (or cDNA) encoding the amino acid sequence of the heavy chain antibody polypeptide of SEQ ID NO: 22 is shown in SEQ ID NO: 23 (Fig. 40B); the nucleic acid sequence (or cDNA) encoding the polypeptide amino acid sequence
23/183 deo of the light chain antibody of SEQ ID NO: 24 is shown in SEQ ID NO: 25 (Fig. 40A).
In various embodiments targeting any of the foregoing humanized monoclonal antibodies of the invention, the CH region of the monoclonal antibody is selected from IgG1, IgG2a, IgG2b, IgG3, IgG4, IgA, IgE or IgM. In one embodiment, the CH region is lgG1. In one embodiment, the CL region is selected from the κ or λ isotype. In one embodiment, the CL region is of the κ isotype. In other embodiments, CDRs, that is, CDR1, CDR2 and / or CDR3, of humanized antibodies or fragments that bind to antigens thereof, as described here, are adopted for binding and / or neutralizing toxin A and / or C. difficile toxin B in products and methods according to the invention.
In another aspect, a C. difficile antitoxin A antibody or a fragment thereof, wherein the V region of the L chain comprises a sequence selected from one or more of SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 7 is provided. An antitoxin B antibody from C. difficile or a fragment thereof is also provided, wherein the V region of the L chain comprises a sequence which is shown in SEQ ID NO: 10. An antitoxin A antibody from C. difficile or a fragment thereof, wherein region V of the H chain comprises a sequence selected from one or more of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5 and SEQ ID NO: 6. Also provided is a C. difficile antitoxin B antibody or a fragment thereof, wherein the V region of the H chain comprises a sequence selected from one or more of SEQ ID NO: 8 or SEQ ID NO: 9.
In another aspect, an isolated antibody or antigen-binding fragment thereof, which (i) specifically binds to C. difficile toxin A and which cross-competes for binding to C. difficile toxin A with a monoclonal antibody produced by a hybridoma cell line deposited under ATCC Accession No. PTA-9692 or (ii) specifically binds to an C. difficile toxin A epitope defined by a monoclonal antibody produced by the deposited hybridoma cell line under ATCC Accession No. PTA-9692, where the epitope
24/183 defined for the monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9692 comprises a region outside the receptor binding domain, for example, the translocation domain, of the C toxin difficile A is provided. In one embodiment, the antibody is in humanized form. In one embodiment, the antibody is in chimeric form.
In another aspect, an isolated antibody or antigen-binding fragment thereof, which (i) specifically binds to C. difficile toxin A and which cross-competes for binding to C. difficile toxin A with a monoclonal antibody produced by a hybridoma cell line deposited under ATCC Accession No. PTA-9694 or that (ii) specifically binds to an C. difficile toxin A epitope defined by a monoclonal antibody produced by the deposited hybridoma cell line under ATCC Accession No. PTA-9694, wherein the epitope defined for the monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9694 comprises at least two sites in the receptor, for example, C-terminal receptor binding epitopes, of C. difficile A toxin is provided. In one embodiment, the antibody is in humanized form. In one embodiment, the antibody is in chimeric form.
In another aspect, an isolated antibody or antigen-binding fragment thereof, which (i) specifically binds to C. difficile toxin A and which cross-competes for binding to C. difficile toxin A with a monoclonal antibody produced by a hybridoma cell line deposited under ATCC Accession No. PTA-9888 or that (ii) specifically binds to an C. difficile toxin A epitope defined by a monoclonal antibody produced by the deposited hybridoma cell line under ATCC Accession No. PTA-9888, wherein the epitope defined for the monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9888 comprises binding epitopes to the C-terminal receptor of the C. difficile toxin A is provided. In one embodiment, the antibody is in humanized form. In a
25/183 modality, the antibody is in chimeric form.
In another aspect, an isolated antibody or antigen-binding fragment thereof, which (i) specifically binds to C. difficile B toxin and cross-competes for binding to C. difficile B toxin with a monoclonal antibody produced by a hybridoma cell line deposited under ATCC Accession No. PTA-9693 or (ii) specifically binds to an C. difficile toxin B epitope defined by a monoclonal antibody produced by the deposited hybridoma cell line under ATCC Accession No. PTA-9693, where the epitope defined for the monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9693 comprises the toxin B N-terminal enzyme domain C. difficile is provided. In one embodiment, the epitope defined for the monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9693 comprises a 63 kDa fragment generated by treatment with toxin B caspase 1 comprising the domain of C. difficile toxin B N-terminal enzyme. In one embodiment, the epitope defined for the monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9692 comprises the translocation domain of C. difficile toxin B.
In one embodiment, the epitope defined for the monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9692 comprises a 167 kDa fragment generated by treatment with toxin B caspase 1 and a protein of 63 kDa which comprises untreated toxin B. In one embodiment, the antibody is in humanized form. In one embodiment, the antibody is in chimeric form.
In another aspect, a method of producing a monoclonal antibody that binds and neutralizes toxin A or C. difficile toxin B, which involves immunizing one or more recipient animals with inactive toxoid A at periodic intervals; strengthening animals with increasing amounts of active toxin A or active toxin B at periodic intervals; getting
26/183 hybridoma cells starting from immune cells of the immunized and reinforced animal fused with a suitable immortalized cell line, in which the hybridoma cells produce and secrete anti-toxin A antibodies that bind and neutralize C. difficile toxin A or anti-toxin B antibodies that bind and neutralize C. difficile toxin B is provided. In one embodiment, C. difficile anti-toxin A neutralizing monoclonal antibodies and / or C. difficile anti-toxin B neutralizing monoclonal antibodies are isolated. In methods of the method, the steps of immunization and booster include an adjuvant. In one embodiment, the adjuvant is Quil A. In other embodiments of the method, the immunization and booster steps are performed at periodic intervals every three weeks. In other modalities, recipient animals are immunized with two or three doses of toxoid A, followed by three to five boosters of increasing doses of active toxin A or active toxin B.
In another aspect, an isolated antibody or an antigen-binding fragment thereof, which inhibits, blocks or prevents the toxicity of C. difficile toxin A by inhibiting, blocking or preventing internalization of toxin A and cytocellular toxicity is provided. In one embodiment, the antibody is a monoclonal antibody. In one embodiment, the antibody is a humanized or chimeric antibody. In one embodiment the antibody is PA-39 (ATCC Accession No. PTA-9692) or humanized PA-39. In one embodiment, the antibody is PA-50 (ATCC Accession No. PTA-964) or humanized PA-50. In other embodiments, the antibody competes with humanized PA-39, humanized PA-39, humanized PA-50 or PA-50 for binding to toxin A. In one embodiment, the antibody binds to an isolated site in a region of toxin A outside of the toxin receptor binding domain
A. In one embodiment, the antibody competes with PA-39 or a humanized form of the same for binding to an isolated site in a toxin A region outside the toxin A receptor binding domain. In one embodiment, the antibody binds to at least two sites in the toxin A receptor binding domain. In one embodiment, the antibody competes with PA-50 or a humanized form of it by binding to at least two sites in the
27/183 toxin A receptor binding domain. In one embodiment, the antibody inhibits toxin A toxicity through a mixed competitive mechanism of action. In one embodiment, the antibody inhibits toxin A toxicity through a competitive mechanism of action. All of the above embodiments are understood to encompass the antigen-binding fragment of the antibody.
In another aspect, an isolated antibody or antigen-binding fragment thereof, which inhibits, blocks or prevents the toxicity of C. difficile toxin B by binding to an epitopic site in the N-terminal enzyme region of toxin B is provided . In one embodiment, the antibody is a monoclonal antibody. In one embodiment, the antibody is a humanized or chimeric antibody. In one embodiment the antibody is PA-41 (ATCC Accession No. PTA-9693) or a humanized form of PA-41. In one embodiment, the antibody competes with humanized PA-41 or PA-41 for binding to the C. difficile toxin B enzyme N-terminal region. In one embodiment, the antibody competes with humanized PA-41 or PA-41 for binding to an isolated site in the N-terminal enzymatic region of C. difficile toxin B. In one embodiment, the antibody inhibits toxin B toxicity through a mixed competitive mechanism of action.
Another aspect provides a vaccine or an immunogenic agent comprising portions, fragments or peptides of toxin A and / or toxin B of C. difficile containing epitopic regions recognized and / or linked by one or more of monoclonal antibody PA-39 (No ATCC Accession PTA-9692), a humanized form of PA-39, the monoclonal antibody PA-50 (ATCC Accession No. PTA-9694), a humanized form of PA-51, the monoclonal antibody PA-41 (ATCC Accession No. PTA-9693), a humanized form of PA-41, an antibody that competes for the binding of toxin A with the monoclonal antibody PA-39 or a humanized form of it, an antibody that competes for the binding of toxin A with monoclonal antibody PA-50 or a humanized form thereof or an antibody that competes for binding toxin B with monoclonal antibody PA-41 or a humanized form thereof. In one embodiment, the vaccine or a
28/183 immunogenic people comprise portions, fragments or peptides of toxin A and C. difficile toxin B containing epitopic regions recognized and / or linked by one or more monoclonal antibody PA-39 (ATCC Accession No. PTA- 9692), a humanized form of PA-39 or an antibody that competes for the binding of toxin A and toxin B with the monoclonal antibody PA-39 or a humanized form thereof. In one embodiment, the portions, fragments or peptides that contain toxin A and / or toxin B epitopes of the vaccine or immunogenic agent are derived from the toxin A or toxin B protein by proteolytic divination. In one embodiment, fragments, portions or peptides of toxin A from the vaccine or immunogenic agent are produced by proteolytic dividing by errterokinase. In one embodiment, the fragments, portions or peptides of the toxin B of the vaccine or immunogenic agent are produced through proteolytic divination by caspase (caspase 1). In one embodiment, the portions or fragments containing the vaccine or immunogenic agent epitope are peptides chemically or recombinantly synthesized from the toxin A or toxin B protein. In one embodiment, the fragments, portions or peptides from the vaccine or immunogenic agent containing one or more epitopic regions of toxin A and / or toxin B that are recognized and linked by the antibody are derived from one or more of the amino terminals of toxin A; the amino terminals of toxin B; the toxin A carboxy terminals; the toxin B carboxy terminals; the toxin A receptor binding domain; a region outside the toxin A receptor binding domain; the toxin B receptor-binding domain; the N-terminal enzymatic region of toxin B; the toxin A glycosyltransferase domain; the toxin B glycosyltransferase domain; the proteolytic domain of toxin A; the proteolytic domain of toxin B; the hydrophobic pore-forming domain of toxin A; or the hydrophobic pore-forming domain of toxin B. In one embodiment, fragments or portions containing toxin A or toxin B epitopes are <300 kDa, -158-160 kDa, ~ 100-105 kDa, for example, 103 kDa, -90-95 kDa, for example, 91 kDa and / or ~ 63-68 kDa, for example, 63 kDa or 68 kDa in size. In one embodiment, fragmen
29/183 tos or portions containing toxin A epitope are -158-160 kDa; -90-95 kDa, for example, 91 kDa and / or -63-68 kDa, for example, 68 kDa in size. In one embodiment, the fragments or portions that contain toxin B epitope are -100-105 kDa, for example, 103 kDa and / or -63-68 kDa, for example, 63 kDa in size. In any of the vaccine or immunogenic modalities, toxin A or toxin B or fragment, portion or peptide thereof, is that of the strains provided here.
Another aspect provides a method of neutralizing, inhibiting, blocking, reducing, improving, curing or treating an infection caused by C. difficile or a disease associated with C. difficile in an individual who needs it, which comprises administering to the individual an efficient amount of the vaccine or immunogenic agent described above. In one embodiment of the method, a humoral response to toxin A and / or toxin B of C. difficile after administration of the vaccine or immunogenic agent is activated in the individual, thus producing antibodies anti-toxin A and / or anti-toxin B that can specifically neutralize , inhibit, block, reduce, improve, cure or treat disease associated with C. difficile or CDAD, including mild to severe diarrhea and in some cases associated with serious life-threatening complications, such as pseudomembranous colitis, toxic megacolon, intestinal perforation, septicemia and death, in the individual. In one embodiment of the method, antibodies that are activated through the individual's humoral response include antibodies that have specificities and mechanisms of action similar or identical to the mAbs of the invention or antibodies that compete with the mAbs of the invention in neutralizing toxin A and / or of C. difficile toxin B or that compete with the mAbs of the invention in the mechanism of action involved in neutralizing toxin A and / or C. difficile toxin B.
In another aspect, a method of neutralizing, inhibiting or blocking the activity of toxin A and / or toxin B within or against a cell susceptible to infection caused by C. difficile, which comprises the contact of the cell with an antibody or fragment antigen binding
30/183 same, according to the present invention, in which the antibody or antigen-binding fragment thereof neutralizes, inhibits or blocks the activity of toxin A and / or toxin B inside or against the cell via a competitive or mixed competitive action mechanism is provided. In one embodiment of the method, the antibody is one or more of a monoclonal antibody, a humanized antibody or a chimeric antibody. In one embodiment of the method, the cell, for example, an intestinal epithelial cell, is in an individual and the antibody or antigen-binding fragment thereof is administered in an efficient amount to the individual. In one method embodiment, the toxin is toxin A. In one method embodiment, the toxin is toxin B. In one method embodiment, the toxin is toxin A and the mechanism of action is a competitive inhibiting action mechanism. In one embodiment of the method, the antibody or antigen-binding fragment thereof is PA-50 (ATCC Accession No. PTA-9694), a humanized form of it or an antibody or fragment thereof, which competes with PA-50 for neutralizing the activity of toxin A. In one embodiment of the method, the toxin is toxin A and the mechanism of action is a mixed competitive inhibition mechanism of action. In one embodiment of the method, the antibody or antigen-binding fragment thereof is PA-39 (ATCC Accession No. PTA-9692), a humanized form of it or an antibody or fragment thereof, which competes with PA -39 for the neutralization of toxin A activity. In one method, the toxin is toxin B and the mechanism of action is the mechanism of action of mixed competitive inhibition. In one embodiment, the antibody or antigen-binding fragment thereof is PA-41 (ATCC Accession No. PTA-9693), a humanized form of it or an antibody or fragment thereof, which competes with PA-41 for neutralizing the activity of toxin B.
These and other aspects of the invention will be described in further detail in association with the detailed description of the invention.
Brief Description of Drawings
Figs. 1A-1C demonstrate the specificity of mAbs of the C. difficile antitoxin invention for toxin A and / or toxin B via ELI31 / 183
SA. ELISA plates were coated with toxin A (filled circles) or toxin B (empty squares) overnight at 4 ° C. After the plates were washed and blocked, murine mAb PA-38 (A), PA-39 (B) or PA-41 (C) was titrated and added to the plates. The binding of the monoclonal antibody was detected with HRP-conjugated anti-goat IgG-Fc. OD was measured on a SpectraMax M5 Plate Reader (Molecular Devices).
Figs. 2A-2D provide results of Biacore binding characterization assays using murine PA-38, PA-39, PA-41 and PA-50 mAbs. The binding specificity was determined using a Biacore 3000 instrument (GE Healthcare). The mAbs (PA-38 (2A), PA-39 (2B), PA-50 (2C), PA-41 (2D) or non-specific mAb as a control were immobilized covalently on the surface of the CM5 sensor chip (GE Healthcare) to approximately 10,000 resonance units (UR) according to the manufacturer's instructions for coupling amine, binding experiments were performed at 25 ° C in PBS, toxin A or purified toxin B (List Biological Laboratories) at 30 nM was passed by control (non-specific mAb) and test flow cells at a flow rate of 5 pL / min with an association phase (600s for PA-38, PA-39 and PA-41; and 300s for PA-50) and a dissociation phase (300s for PA-38, PA-39 and PA-41; and 600s for PA-50). The graphs are presented in UR over time.
Figs. 3A-3E and 3F-3H show the results of toxin-antibody binding kinetics as determined by Biacore. For Figs. 3A-3E, murine mAbs were captured using a CM5 sensor chip prepared with the Biacore mouse antibody capture kit. The toxin was then passed through the flow cells in varying concentrations (0.4 -100 nM, two-fold increase) at a flow rate of 30 pL / min. All concentrations of mAb were tested in duplicate and the chip surface was regenerated after each run using the conditions specified in the kit. Changes in UR were recorded and analyzed using the 1: 1 binding model of the Bia Evaluation Software (Langmuir) which calculated the K _D of the mAb for the toxin. Fig. 3A: binding of PA-38 to toxin A; Fig.
32/183
3B: binding of PA-50 to toxin A; Fig. 3C: binding of PA-39 to toxin A; Fig. 3D: PA-39 binding to toxin B; and Fig. 3E: binding of PA-41 to toxin B. For Figs. 3F-3H, as before, murine mAbs, i.e., mPA-50, _m PA-41 or mPA-39, were covalently linked to a CM5 sensor chip using the amine coupling method. Toxin A (named line (red)) or toxin B (named line (blue)) at 30 nM was passed through the test flow cells (mPA-50, mPA-41 or mPA-39) at a flow rate of 5 pL / min. The results show that mPA-50 binds selectively to toxin A (Fig. 3F) and mPA-41 binds selectively to toxin B (Fig. 3G). mPA-39 binds preferentially to toxin A, but also shows cross-reactivity to toxin B (Fig. 3H).
Fig. 4 demonstrates the in vitro neutralization activity of toxin A activity using purified murine mAb PA-39 on CHO-K1 cells. For cytotoxicity measurements, toxin A was incubated with varying concentrations of PA-39 for 1 hour at 37 ° C (Example 3A). The mAb-toxin mixtures were then added to the CHO-K1 cells plated in 96-well plates at 2,000 cells / well and incubated for 72 hours. Cell survival was compared in treated and untreated cultures and the concentration of mAbs required for 50% cytotoxicity neutralization (EC ₅₀ ) was calculated. Cell viability was determined using CelITiter-Blue; the raw data were normalized for the untreated control wells. The values were plotted using Prism and the curves were calculated using a sigmoidal dose response model (slope of the variable line). The curve was then used to determine EC ₅₀ of mAb. The data points represent the average of three wells on the same plate.
Fig. 5 demonstrates the in vitro neutralizing activity of toxin B activity using purified murine mAb PA-41 in CHO-K1 cells. For cytotoxicity measurements, toxin B was incubated with varying concentrations of PA-41 for 1 hour at 37 ° C (Example 3B). The mAb-toxin mixtures were then added to the CHO-K1 cells plated in 96-well plates at 2,000 cells / well and incubated for
33/183 hours. Cell survival was compared in treated and untreated cultures and the concentration of mAbs required for 50% cytotoxicity neutralization (EC ₅₀ ) was calculated. Cell viability was determined using CelITiter-Blue; the raw data were normalized for the untreated control wells. The values were plotted using Prism and the curves were calculated using a sigmoidal dose response model (slope of the variable line). The curve was then used to determine EC ₅₀ of mAB. The data points represent the average of three wells on the same plate.
Fig. 6 demonstrates the in vitro neutralization activity of toxin A activity using purified murine mAbs PA-38 and PA-50 in T-84 cells. (Example 3C). T-84 cells were seeded (15,000 cells / well) in 96-well plates and treated with a combination of titrated mAb (PA-38 () or PA-50 (A)) and toxin A (60 ng / ml). After incubation (72 hours), cell survival was compared in treated and untreated cultures and the concentration of mAbs required for 50% cytotoxicity neutralization (EC ₅₀ ) was calculated. Cell viability was determined using CelITiter-Blue; the raw data were normalized for the untreated control wells. The values were plotted using Prism and the curves were calculated using a sigmoidal dose response model (slope of the variable line). The curve was then used to determine EC ₅₀ of mAb. The data points represent the average of three wells on the same plate.
Fig. 7 demonstrates the results of testing PA-38 () or PA-50 (A) murine mAbs for their ability to block or prevent toxin A-induced hemagglutination of rabbit red blood cells (RBCs). Toxin A (2 pg / ml) was combined with various dilutions of PA-38 or PA-50 and the mixture was added to the plates containing 50 µl of rabbit erythrocytes. The plates were incubated at 4 ° C for 4 hours. Hemagglutination was quantified as color intensity using ImageQuant 400 (GE Healthcare) dot array analysis. Data were transformed into% control, with 100% representing no hema
34/183 glutination. The data points represent the average of three wells analyzed on the same plate.
Fig. 8 demonstrates the activity of the C. difficile antitoxin mAbs of the invention in preventing the disruption of a Caco-2 cell monolayer by toxin A. Caco-2 cells were seeded (25,000 cells / well) in the upper chamber of a 96-well Multiscreen Caco-2 Assay plate (Millipore). After a 10-14 day incubation, the formation of a compact monolayer was confirmed by measuring the transepithelial electrical resistance (TEER) using an epithelial voltohmometer (World Precision Instruments). After the monolayer integrity was established and determined, toxin A (25 ng / ml) and murine mAbs diluted in series (PA-38 () or PA-50 (A)) were added to the upper chamber of the assay plate. The plates were incubated for 18-24 hours and the TEER value was measured using the voltohmometer. Monolayer integrity was compared in untreated and toxin-treated wells. Inhibition data were fitted to a sigmoidal dose response curve with non-linear regression using the GraphPad Prism software in order to determine the concentration of mAb required for 50% toxin inhibition (EC ₅ o) ·
Figs. 9A-9C demonstrate the ability of antitoxin A mAbs PA-38 (9A) and PA-50 (9B) to neutralize toxin A activity in vivo. Swiss Webster female mice (6-8 weeks old, 5 mice / group) received injection (ip) of murine mAb PA-38 or murine mAb PA-50 in the indicated amounts or with PBS (200 μί_) on day 0. A neutralizing activity of a comparator anti-toxin monoclonal antibody, referred to here as CDA-1, was evaluated at the indicated antibody amounts (9C). The CDA-1 antitoxin comparator mAb was produced through the synthesis (DNA2.0) of nucleic acids encoding 3D8 heavy and light chain variable regions (W02006 / 121422 and US2005 / 0287150), which were cloned into expression vectors of full-length human IgG1 (pCON-gamma1 and pCON-kappa). The comparator mAb CDA-1 was expressed and produced in CHO-KSV1 cells and purified as described in
35/183 section of Examples. The mice were then injected with 100 ng of toxin A (200 µl) on day 1 and were monitored daily throughout the first 72 hours and weekly thereafter. The results show that both PA-38 and PA-50 mAbs are able to completely inhibit toxin A-associated toxicity after a single dose of 2 pg of - mAb / animal, while the comparator mAb CDA-1 (5 pg / animal) failed to completely inhibit toxicity associated with C. difficile toxin A.
Fig. 10 demonstrates the ability of mAb PA-41 to neutralize toxin B activity in vivo. Swiss Webster 10 mouse females (6-8 weeks of age, 5 mice / group) received injection (ip) of murine mAb PA-41 in the indicated amounts or PBS (200 pL) on day 0. The mice then received injection of 100 ng of toxin B (200 μΙ_) on day 1 and were monitored daily over the first 72 hours and weekly thereafter. The results of this experiment show that 15 mAb PA-41 completely inhibits the toxicity associated with C. difficile toxin B after a single 5 pg dose of mAb / animal. A similar experiment was performed using a monoclonal antibody comparator antitoxin B, referred to as mAb CDB-1 comparator here. The CDB-1 antitoxin B mAb was produced through the synthesis of nucleic acids (DNA2.0) 20 that encode 124 heavy and light chain variable regions (WO2006 / 121422 and US2005 / 0287150), which were cloned into expression vectors of full-length human IgG1 (pCON-gama1 and pCON-kappa). The comparator CDB-1 mAb was expressed and produced in CHO-KSV1 cells and purified as described in the Examples section here. The 25 results of these experiments did not show toxin B neutralization activity by the mAb CDB-1 comparator, even in an amount of 250 pg.
Fig. 11 demonstrates the ability of a combination of PA-38 and PA-41 murine mAbs (PA-38 + PA-41) of the invention to neutralize toxin A and toxin B activity in vivo. Swiss Webster female mice (6-8 weeks of age, 5 mice / group) received injection (i.p.) of the combination of mAb PA-38 + PA-41 or PBS (200 μΙ_) on day 0.
36/183 mice were then injected with 100 ng of a combination of toxin A and toxin B (200 μ! _) On day 1 and were monitored daily throughout the first 72 hours and weekly thereafter. The graphic representations for toxin, PA-38 alone (empty circles) and PA-41 i5 alone (filled diamonds) overlap in the graph. The results show that neither mAb PA-38 (empty circles) nor mAb PA-41 (filled lozenges) alone was sufficient to inhibit the effects of both toxins and did not protect animals from infection by C. difficile. In contrast, the combination of PA-38 and PA-41 (PA-38 + PA-41) at 50 10 pg each (empty inverted triangles) was able to protect infected animals and prevent toxin-related death in 4 of 5 test animals. The combination of PA-38 and PA-41 (PA-38 + PA-41) at 5 pg each (filled circles) provided some protection against toxin A and C. difficle toxin B in the infected test animals.
Figs. 12A and 12B demonstrate the pharmacokinetic results (PK) in hamsters for murine mAbs PA-38 and PA-41. The hamsters received i.p. with 2 mg / kg (□) or 10 mg / kg () of PA-38 (12A) or PA41 (12B) mAb. The animals' blood was collected at regular intervals and the serum was analyzed using an ELISA with toxin-coated plates and
Goat anti-world IgG, HRP conjugate for detection. The resulting curves illustrate the dose-dependent response in the 2 mg / kg and 10 / mg / kg groups for each antibody. WinNonLin analysis was performed on each curve. Both monoclonal antibodies have a terminal half-life greater than 6 days.
Fig. 13 illustrates the survival results of the hamster study described in Example 5B. In this study, hamsters were treated with clindamycin, inoculated with C. difficile (infected control, Group 3) and then treated with vancomycin (□ 20 mg / kg, Group 4), a combination of PA-38 + PA-41 murine mAbs (□ 50, 50 mg / kg, Group 6) or a combination of PA-39 + PA-41 mAbs (□ 50, 40 mg / kg, Group 7). All animals in the uninfected control (Group 1) and in the control treated with polyclonal goat abs (group 5) survived. Animals treated with
37/183 combination of antitoxin A and antitoxin B mAbs of the invention survived and were protected against C. difficile toxicity for the duration of the study.
Fig. 14 shows the average body weight (in grams) of hamsters from the study described in Example 5B. Animal treatment groups are as follows: uninfected control (♦, Group 1); control treated with vancomycin (, Group 4); group treated with the combination of mAb PA-38 + murine PA-41 (x, Group 6) or group treated with the combination of mAb PA-39 + mAb PA-41 (·, Group 7). The animals in the infected control group (Group 3) did not survive for 5 days; therefore, a measurement of body weight after infection could not be made for Group 3.
Figs. 15A-15D represent the postmortem necropsy results from the hamster study described in Example 5B. Representative animals from each of the relevant study groups were evaluated: (A) Group 1, uninfected control; (B) Group 3, infected control; (C) Group 6, group treated with a combination of mAb PA-38 + murine PA-41; and (D) Group 7, group treated with a combination of mAb PA-39 + murine PA-41. The arrows indicate the caecum of each hamster. The cecum was remarkably red and inflamed in the infected control group 3 (B). In contrast, hamsters' caecae in Group 6 (C) and Group 7 (D) were similar to caecins in healthy uninfected control animals in Group 1 (A).
Figs. 16A and 16B-1 and B-2. Fig. 16A illustrates the survival results of the hamster study described in Example 5C. In this study, hamsters were treated with clindamycin, inoculated with C. difficile (infected control, Group 1) and then different groups of animals were treated with vancomycin (♦ 20 mg / kg, Group 2), the combination of PA- 39 + PA-41 (A50 + 50 mg / kg, Group 3), murine mAb PA-41 alone (o 50 mg / kg, Group 4), murine mAb PA-38 alone (□ 50 mg / kg, Group 5) , murine mAb PA-39 alone (□ 50 mg / kg, Group 6) or murine mAb PA-50 alone (□ 50 mg / kg, Group 7). All animals in the uninfected control (Group 1) survived during the course of the study. Fig. 16B-1 illustrates the survival results of the study animals
38/183 with hamster described in Example 5E. Kaplan-Meier survival curves are shown for animals treated with clindamycin and then inoculated with C. difficile (, Infected control, Group 2); treated with vancomycin (□, 20 mg / kg, Group 3); treated with a 1.1 combination of humanized PA-50 + PA-41 mAbs ((hPA-50 + hPA-41), □, 50 + 50 mg / kg, Group 4); treated with a 1: 1 combination of humanized PA-50 + PA-41 mAbs ((hPA-50 + hPA-41), o, 20 + 20 mg / kg, Group 5); treated with a 1: 1 combination of CDA-1 mAbs + CDB-1 comparators ((CDA-1 + CDB-1), □, 50 + 50 mg / kg, Group 6); or treated with a 1: 1 combination of CDA-1 mAbs + CDB-1 comparators ((CDA-1 + CDB-1), □ 20 + 20 mg / kg, Group 7). Fig. 16B-2 illustrates the weight change results of the hamster study described in Example 5E. The mean body weights (□ SD) of animals over time in the different treatment groups described for Fig. 16B-1 were compared with uninfected control animals.
Figs. 17A-17C show caspase 1 treatment of C. difficile toxin B. (A): Full-length C. difficile toxin B and its domains. (B): SDS-PAGE analysis (reducer) with 3-8% toxin B Tris-Acetate (TcdB) and toxin B treated with caspase 1. Four fragments of toxin were observed: 193, 167, 103 and 63 kDa . (C): The possible fragments were generated after treatment with toxin B caspase 1.
Figs. 18A-18C show SDS-PAGE (A) and Western blot (B, C) detection of fragments of C. difficile toxin B using antitoxin B mAbs. (A): SDS-PAGE analysis of the toxin B fragments generated by treatment with caspase 1 (same as Fig. 17B); (B): Western blot detection of toxin B fragments using mAb PA-41. (C) detection of toxin B fragments using murine mAb PA-39.
Figs. 19A-19E show the characterization of murine C. difficile antitoxin mAbs by binding with Biacore. The competitive binding of antitoxin mAbs was evaluated. (A): mAb PA-41 binds to a single epitope on toxin B. (B): mAb PA-39 binds to a single epitope on toxin A. (C): mAbs
39/183
PA-39 and PA-41 bind to different epitopes on toxin B. The binding of mAb PA-41 to toxin B is epitopically different from the binding of the antitoxin B comparator CDB-1 antibody to toxin B. (D) mPA-41 immobilized on the CM5 chip captures toxin B, but is unable to bind to additional mA-41, 5 thus indicating that there is only one mPA-41 binding epitope. The addition of the mAb CDB-1 comparator provided an increased signal, demonstrating that mPA-41 and mAb CDB-1 comparator bind to different epitopes on toxin B. (E) Western blot analysis using toxin B, treated or untreated with caspase 1, demonstrating that mPA-41 and mAb CDB-1 comparator 10 have different binding patterns and bind different epitopes on toxin B.
Figs. 20A-20C show the dividing of toxin A from C. difficile using enterokinase (ΕΚ). (A): Full-length C. difficile toxin A and its domains. (B): SDS-PAGE analysis (reducer) with 3-8% -15 toxin A Tris-Acetate (TcdA) and toxin A treated with EK. (C): The possible fragments generated after treatment with toxin A EK at 25 ° C for 48 hours.
Figs. 21A-21C show Coomassie Blue staining (SDS-PAGE), (A) and Western blot detection (B, C) of fragments of C. difficile toxin A using murine antitoxin A mAbs. (A): SDS-PAGE analysis of toxin A fragments generated through treatment with EK (same as Fig. 20B). (B): Western blot detection of fragments of toxin A using mAb PA-50. (C): Western blot detection of fragments of toxin A using mAb PA-39. In Figs. 21B and 21C, band 25 in kDa is -158 kDa and can be considered to be -158-160 kDa.
Figs. 22A-1 and A-2-22F. Figs. 22A-1 and A-2-22D show the characterization of the binding of the murine antitoxin A mAb to C. difficile toxin A using a Biacore binding assay. Fig. 22A-1: PA-50 mAb was observed to bind to various sites in toxin A. Fig. 22A-2: PA-50 mAb was immobilized on the sensor chip and then sequentially placed in contact with purified toxin A , Additional PA-50 and mAb CDA-1 comparator (WO / 2006/121422; US2005 / 0287150). Fig. 22B: toxin A captured by the
40/183 mAb CDA-1 comparator on the Biacore chip additionally binds to additional CDA-1 and PA-50 mAbs, showing differences in the toxin A epitopes bound by antibodies. Fig. 22C: the binding epitope with PA-39 mAb in toxin A is different from the binding epitope of the comparator mAb CDA-1 in toxin A. Fig. 22D: the competitive binding of murine mAbs PA-50 and PA-39 toxin A was performed using Biacore. The mAb PA-50 immobilized on the CM5 chip captures toxin A, which can bind to additional mPA-50 plus mPA-39, demonstrating that there are several copies of the mPA-50 epitope in toxin A and that mPA-50 and mPA -39 bind to different epitopes on toxin A. Figs. 10 22E and 22F: Biacore results were confirmed by Western blot analysis using toxin A that was untreated or treated with the enterokinase enzyme (ΕΚ). (E): mPA-39 and mAb CDA-1 comparator show different binding patterns with toxin A treated with EK (Range: TcdA / EK), thus indicating different binding domains and epitopes in toxin A. (F): mPA-50 and mAb CDA-1 comparator bind to the same toxin A domain, but to different epitopes.
Figs. 23A and 23B demonstrate the neutralization activity of PA-41 in vitro against a distinct set of twenty C. difficile toxigenic clinical isolates, including 6 isolates BI / NAP1 / 027, 3 reference strains 20 (VPI 10463, ATCC 43596 and 630 ), 2 isolates negative for toxin A / positive for toxin B (toxA- / toxB +), 3 isolates from outpatients and 6 other clinical isolates. Fig. 23A shows the neutralization activity of murine mAb PA-41 in CHO-K1 cells against supernatants generated from cultures of different C. difficile clinical isolates that are shown in Example 8, Table 6. The mAb PA-41 The purified material was serially diluted and then mixed with a supernatant with predefined dilution factor that can cause> 90% cell death. The mixtures were incubated for 1 hour at 37 ° C and then added to the CHO-K1 cells. The cells were incubated for 72 hours and cell viability was measured 30 using Cell-Titer Blue. Fig. 23B illustrates the neutralization activity of humanized hPA-41 mAb as well as that of comparator mAb CDB-1 against the 2 reference strains of C. difficile (VPI 10463 and ATCC 43596) and 6
41/183 C. difficile strains BI / 027/027 (CCL678, HMC553, Pitt 45, CD196, Montreal
5.1 and Montreal 7.1). The neutralization activity of hPA-41 mAb (filled squares) and comparator CDB-1 mAb (filled triangles) in CHO-K1 cells against reference strain supernatants (VPI 10483 and ATCC 43596) and BI / NAP1 / 027 strains (CCL678 , HMC553, Pitt 45, CD196, Montreal
5.1 and Montreal 7.1) is shown.
Figs. 24A and 24B demonstrate the neutralization activity of mAb PA-50 in vitro against the C. difficile toxigenic clinical isolates described for Figs. 23A and B. Fig. 24A shows the neutralization activity of murine mAb PA-50 in T-84 cells against supernatants generated from cultures of different C. difficile clinical isolates as shown in Example 8, Table 6. The mAb PA -50 purified was serially diluted and then mixed with a supernatant with predefined dilution factor which can cause> 90% cell death. The mixtures were incubated for 1 hour at 37 ° C and then added to T-84 cells. The cells were incubated for 72 hours and cell viability was measured using Cell-Titer Blue. Fig. 24B shows the results of similar experiments performed using humanized hPA-50 mAb and the comparator mAb CDA-1 on T-84 cells. The neutralization activity of hPA-50 (filled squares) and comparator CDA-1 (filled triangles) in T-84 cells against supernatants generated from six strains BI / NAP1 / 027 (CCL678, HMC553, Pitt 45, CD196, Montreal 5.1 and Montreal 7.1) is shown. For Fig. 24A: *: N / A: Not applicable; no toxin A was produced from toxin A- / toxin B + F1470, 8864, CCL13820 and CCL14402 strains; The toxin A titer was very low; no measurable cytotoxicity at T-84 using supernatant; ^Λ : Not applicable; toxin A was not produced from toxin A- / toxin B + strains or the concentration was too low.
Figs. 25A-25D demonstrate the neutralization of toxins produced by different strains of C. difficile. Figs. 25A and 25B show neutralization activity of PA-39 murine mAb in T-84 cells against supernatants generated from cultures of different clinical isolates from
42/183
C. difficile as shown in Example 8, Table 6. The mAb PA-39 (hybridoma supernatant) was serially diluted and the dilution factor for each supernatant is shown. Fig. 25B shows the results of similar experiments performed using murine mAb PA-39 and the comparator mAb CDA-1 on T-84 cells. The neutralization activity of PA-39 (filled squares) and the comparator mAb CDA-1 (filled triangles) in T-84 cells against supernatants generated from six strains BI / NAP1 / 027 (CCL678, HMC553, Pitt 45, CD196, Montreal 5.1 and Montreal 7.1) is shown. For Fig. 25A: *: N / A: Not applicable; no toxin A was produced from toxin A- / toxin B + F1470, 8864, CCL13820 and CCL14402 strains; The toxin A titer was very low; no measurable cytotoxicity on T-84 using the supernatant; ^Λ : Not applicable; toxin A was not produced from toxin A- / toxin B + strains or the concentration was too low. In Fig. 25C, the humanized anti-toxin A mAb PA-50 and the anti-toxin A comparator mAb CDA-1 were tested for neutralizing the cytoxicity of C. difficile culture supernatants against T-84 cells. (Example 8, Table 7). In Fig. 25D, the humanized anti-toxin B mAb PA-41 and the anti-toxin A comparator mAb CDB-1 were tested for neutralizing the cytoxicity of C. difficile culture supernatants against T-84 cells. (Example 8, Table 7).
Fig. 26 shows that the chimeric mAb PA-41 (cPA-41 mAb) efficiently neutralizes the toxicity of C. difficile toxin B in CHO-K1 compared to the corresponding murine mAb PA-41. Two chimeric PA-41 mAbs were generated; one that had a glycosylation site removed in the VL region, called cPA-41 (NG) and one that had no removal of the glycosylation site, called cPA-41 (G) in the figure. Both cPA-41 (NG) and cPA-41 (G) showed similar levels of neutralization for toxin B (2 pg / mL, TechLab) in CHO-K1 cells and both chimeric mAbs neutralized toxin B at a level similar to that of the parental murine mAb (mPA-41).
Fig. 27 shows that chimeric PA-39 mAb (cPA-39) efficiently neutralizes the toxicity of C. difficile toxin A (1 pg / mL, Listlab) in
43/183 CH0-K1 cells compared to the parental murine PA-39 mAb (mPA-39).
Fig. 28 shows that chimeric PA-50 mAb (cPA-50) efficiently neutralizes the toxicity of C. difficile toxin A (60 ng / mL, TechLab). in T-84 cells compared to parental murine mAb PA-50 (mPA-50).
Fig. 29 shows the in vitro neutralization activity of mAbs
Murine PA-41 (mPA-41) and humanized PA-41 (hPA-41) against C. difficile toxin B. The percentage of cell survival compared to controls was measured using CellTiter Blue. The hPA-41 mAb efficiently neutralizes toxin B toxicity (2 pg / ml, Techlab) in CHO-K1 10 cells with a 6 pM EC ₅ o and was virtually equipotent to the parental murine monoclonal antibody (mPA-41).
Fig. 30 shows the in vitro neutralization activity of murine PA-39 (mPA-39) and humanized PA-39 (hPA-39) mAbs against C. difficile toxin A. The hPA-39 mAb efficiently neutralizes the toxicity of toxin A-15 (20 ng / ml, TechLab) in CHO-K1 cells with a 50 µM EC ₅ o and was virtually equipotent to the parental murine monoclonal antibody (mPA-39).
Figs. 31A-31H show the results of in vitro neutralization activity and mechanism of action (MOA) studies using the described mAbs. Cell-based assays using CHO-K1 20 cells and T-84 cells were performed as described in Examples 1, 3 and 7. Fig. 31A shows that the humanized PA-50 mAb (hPA-50) efficiently neutralized toxicity of toxin A (60 ng / ml, TechLab) in T-84 cells compared to parental murine PA-50 mAb (mPA-50). Figs. 31B-D show the neutralization activities of antitoxin A mAbs PA-39 and PA-50 25 compared to those of the mAb CDA-1 antitoxin comparator A. The EC ₅ o and maximum percent inhibition values are as shown in Table A of the Example 7C. Figs. 31E and F show the neutralization activity of mAb PA-41 antitoxin B compared to that of the mAb CDB-1 comparator antitoxin B. The EC50 and maximal percent inhibition values are as shown in Table B of Example 7C. Figs. 31G and H show an ELISA method and results for assessing the ability of antitoxin A mAbs to block toxin A internalization in cells and
44/183 for the evaluation of the activities of these mAbs in the prevention of toxin A internalization in relation to polyclonal control goat antitoxin A antibody control and without antibody control.
Figs. 32A and 32B represent the amino acid sequence 5 of the VH regions of humanized PA-39 (hPA-39), SEQ ID NO: 1 and SEQ ID 'NO: 2. Amino acid residues are shown in the single letter code. The numbers above the strings indicate the locations according to Kabat and others. CDR locations are underlined.
Figs. 33A and 33B represent amino acid sequence 10 of the VL regions of humanized PA-39 (hPA-39), SEQ ID NO: 3 and SEQ ID NO: 4. Amino acid residues are shown in the single letter code. The numbers above the strings indicate the locations according to Kabat and others. CDR locations are underlined.
Figs. 34A and 34B represent the amino acid sequence -15 of the humanized PA-50 (hPA-50) VH regions, SEQ ID NO: 5 and SEQ ID NO: 6. Amino acid residues are shown in the single letter code. The numbers above the strings indicate the locations according to Kabat and others. CDR locations are underlined.
Fig. 35 represents the amino acid sequence of the VL 20 region of humanized PA-50. SEQ ID NO: 7. Amino acid residues are shown in the single letter code. The numbers above the strings indicate the locations according to Kabat and others. CDR locations are underlined.
Figs. 36A and 36B represent the amino acid sequence 25 of the VH regions of humanized PA-41 (hPA-41), SEQ ID NO: 8 and SEQ ID NO: 9. Amino acid residues are shown in the single letter code. The numbers above the strings indicate the locations according to Kabat and others. CDR locations are underlined.
Fig. 37 represents the amino acid sequence of the VL 30 region of the humanized PA-41, SEQ ID NO: 10. The amino acid residues are shown in the single letter code. The numbers above the strings indicate the locations according to Kabat and others. The locations of
45/183
CDRs are underlined.
Figs. 38A and 38B show the nucleic acid sequence and the encoded amino acid sequence of a humanized C. difficile anti-toxin A monoclonal antibody. Fig. 38A represents the amino acid sequence of the humanized anti-toxin A monoclonal antibody light chain that is shown in SEQ ID NO: 16, which is encoded by the nucleic acid sequence that is shown in SEQ ID NO: 17. Fig. 38B represents the amino acid sequence of the humanized monoclonal antibody heavy chain that is shown in SEQ ID NO: 14, which is encoded by the nucleic acid sequence that is shown in SEQ ID NO: 15.
Figs. 39A and 39B show the nucleic acid sequence and the encoded amino acid sequence of a humanized C. difficile anti-toxin A monoclonal antibody. Fig. 39A represents the light chain amino acid sequence of the humanized anti-toxin A monoclonal antibody which is -15 shown in SEQ ID NO: 20, which is encoded by the nucleic acid sequence which is shown in SEQ ID NO: 21. Fig. 39B represents the amino acid sequence of the humanized anti-toxin A monoclonal antibody heavy chain which is shown in SEQ ID NO: 18, which is encoded by the nucleic acid sequence which is shown in SEQ ID NO: 19.
Figs. 40A and 40B show the nucleic acid sequence and the encoded amino acid sequence of a humanized C. difficile anti-toxin B monoclonal antibody. Fig. 40A represents the amino acid sequence of the humanized anti-toxin B monoclonal antibody that is shown in SEQ ID NO: 24, which is encoded by the 25 nucleic acid sequence that is shown in SEQ ID NO: 25. Fig. 40B represents the amino acid sequence of the heavy chain humanized monoclonal antibody antitoxin B which is shown in SEQ ID NO: 22, which is encoded by the nucleic acid sequence which is shown in SEQ ID NO: 23.
Figs. 41A-41C demonstrate in vitro neutralization activity against toxin A or C. difficile toxin B of Fab fragments of murine mAbs compared to the potency of the corresponding whole antibodies. (A): neutralization activity of murine PA-39 and Fab mAb
4QIW3
PA-39 in CH0-K1 cells; toxin A (Techlab, 60 ng / ml); (B): neutralizing activity of murine PA-41 mAb and Fab PA-41 in CHO-K1 cells; toxin B (Techlab, 2 pg / ml); (C): neutralizing activity of murine mAb PA-50 and Fab PA-50 in T-84 cells; toxin A (Techlab, 60 ng / ml).
Figs. 42A and 42B show the antibody concentration profiles resulting from the pharmacokinetics (PK) study described in Example 13 here. Fig. 42A represents the results of PK (serum antibody concentration in pg / mL) over 29 days of animals receiving a single dose of purified humanized antitoxin A mAb PA-50 at a concentration 10 of 1 mg / kg (A) or 5 mg / kg () on day 0. Fig. 42B represents the results of PK (serum antibody concentration in pg / mL) over 29 days of animals receiving a single dose of PA- mAb 41 purified humanized antitoxin B at a concentration of 1 mg / kg (A) or 5 mg / kg () on day 0. Detailed Description of the Invention
-15 The present invention encompasses antibodies and fragments that bind to antigens thereof that provide therapies and treatments without antibiotics that block the pathogenic effects of C. difficile infection and, preferably, provide time for the colon to heal and / or normal microflora of the gastrointestinal tract, for example, colon, visceral, intestine, etc., is established. Monoclonal antibodies as described here, fragments that bind to antigens thereof, such as humanized or chimeric forms of them, provide therapeutic agents and drugs that are not antibiotics both to treat active disease and to prevent recurrent disease in order to allow patients to be25 entities suffering from infection caused by C. difficile and CDAD resolve their illness without relapsing into additional illness or more severe illness or symptoms. In one embodiment, the antibodies of the invention have therapeutic activity against active disease caused by or associated with infection of individuals by C. difficile. In one embodiment, the antibodies of the invention 30 resolve the active disease caused by or associated with infection of individuals by C. difficile. In one embodiment, the antibodies of the invention have therapeutic effects in decreasing the duration and / or severity of
47/183 active disease caused by or associated with C. difficile infection in an individual. In one embodiment, the antibodies of the invention or portions or fragments thereof can be supplied in combination with agents. therapeutic antibiotics.
Monoclonal antibodies (mAbs) against toxins A and B of C.
difficile were generated as described here. Antitoxin mAbs exhibit potent activity both in in vitro assays and in preclinical animal models of infection caused by C. difficile in vivo. More specifically, the mAbs of the invention potentially and durably protect 10 hamsters from mortality in a more relevant and rigid hasmter model of infection caused by C. difficile.
Antibodies provide non-antibiotic approaches to the treatment of CDAD and may allow antibiotics to be discontinued and block the pathogenic effects of C. difficile toxins, thus providing 45 time for the colon to heal and normal intestinal microflora to reestablish. The mAbs as described here can provide therapeutic benefit through their ability to neutralize C. difficile toxins and can be used in passive or active strategies to treat patients with multiple C. difficile recurrences. In particular, mAbs can be used to prevent the recurrence of infection, to treat severe active forms of the disease and to treat patients with various recurrences of diseases associated with C. difficile. The mAbs as described here can provide an efficient means of neutralizing toxins A and B of C. difficile in order to prevent, block or inhibit the recurrence of infection and / or 25 serious and active forms of the disease and various recurrences.
As used here, toxin A and toxin B refer to cytotoxic enterotoxins produced by the microorganism C. difficile. Toxins A and B are the main virulence determinants of C. difficile and toxin negative strains are non-pathogenic. Toxins A and B are transcribed 30 starting from a locus of pathogenicity that includes the toxin, tcdA (toxin A) and tcdB (toxin B) genes and three regulatory genes, of which one (tcdC) encodes a supposed negative transcription regulator of toxin. The protein
48/183
TcdC appears to inhibit toxin transcription during the initial exponential growth phase of the bacterial life cycle. For toxin A, an autocatalytic dividing site between leucine ₅ 43 and glycine ₅ 44 has been described. The divage results from the activation of an aspartyl protease domain by the host's cytosolic inositol phosphate 5 and releases the active glycosyltransferase domain.
Antibodies and fragments that bind to antigens are provided here that specifically bind to toxin A and / or toxin B of C. difficile, compositions containing one or more of such antibodies or fragments that bind to antigens thereof, vectors containing 10 nucleic acid sequences encoding antibodies or fragments that bind to antigens, hybridoma cell lines that produce antibodies and methods of using antibodies or fragments that bind to antigens for treatment or for the prevention of infection caused by C. difficile or disease associated with C. -15 difficile.
It should be understood that when the term antibodies or immunoglobulins is referred to here in the description of the present invention and its various aspects and modalities, it is further understood that this term includes fragments that bind to antigens of such antibodies or immunoglobulins, in a way to avoid excessive repetition of the expression associated with fragments that bind to antigens whenever the term antibodies or immunoglobulins is mentioned. Thus, the present invention encompasses not only antibodies directed against toxin A and C. difficile toxin B, that is, toxin A and toxin B antigens, but also fragments of such antibodies that bind toxin A antigens. and C. difficile toxin B, as further described here. In embodiments, such fragments that bind to antigens are able to neutralize the toxicity of toxin A and / or toxin B in a manner similar to that of the intact antibody.
The antibodies covered by the invention include isolated antibodies that specifically bind to C. difficile toxin A and that competitively inhibit or cross-compete for the specific binding to C. difficile toxin A of an isolated monoclonal antibody produced by
49/183 hybridoma cell line deposited under ATCC Accession No. PTA-9692, PTA-9694 or PTA-9888. The antibodies also include isolated antibodies that specifically bind to C. difficile toxin A and that specifically bind to an epitope on C. difficile toxin A defined by the binding of an isolated monoclonal antibody produced by the hybridoma cell line deposited under the ATCC Accession No. PTA-9692, PTA-9694 or PTA-9888. In some embodiments, the epitope resides in the C-terminal binding domain to the tcdA receptor. In some of these modalities, antibodies competitively inhibit or cross-compete for the binding of PA-50 with tcdA. In other embodiments, the epitope resides in the tcdA translocation domain. In some of these modalities, antibodies competitively inhibit or cross-compete for the binding of PA-39 with tcdA. Such isolated antibodies may comprise monoclonal antibodies, polyclonal antibodies, chimeric antibodies, human antibodies, humanized antibodies and antigen-binding fragments or portions thereof.
The experiments using toxin A enzymatic proteolysis (enterokinase) to assess the specificity of C. difficile anti-toxin A monoclonal antibodies of the invention were performed as described in Example 6. The epitope in toxin A that is recognized and linked by mAb PA- 39 is within a region that is distinct from the toxin A receptor-binding domain, that is, outside the toxin A receptor-binding domain and that is distinct from an epitope bound by a human anti-toxin A antibody reported as binding to a C-terminal toxin A receptor-binding domain (7). As described in Examples 6 and 7 here and shown in Figs. 22 and 31, Biacore assays support a single toxin A binding site for PA-39. Western blot detection of enzymatically digested toxin A demonstrates that PA-39 binds to the region in toxin A that is separated from the regions bound by PA-50 and the comparator mAb CDA-1. The in vitro activity of PA-39 in the toxin potency assay shows changes both in EC ₅ and in the maximum percentage inhibition the more toxin A is added in the culture, indicating a mixed competitive inhibition mechanism for
50/183
PA-39. ELISA detection of toxin A after protection through a 100-fold excess of PA-39 confirmed that inhibition of the toxin by PA-39 occurs through the prevention of toxin internalization and adverse effects of extracellular toxin, for example cytoxicity .
In addition, as described in Examples 6 and 7 here and shown in Figs. 22 and 31, Biacore assays support at least two binding sites on toxin A for PA-50. Western blot detection of enzymatically digested toxin A demonstrates that PA-50 binds to a region in toxin A similar to that bound by the comparator mAb CDA-1. The in vitro activity of PA-50 in the toxin potency assay shows a change in EC50 as more toxin A is added to the culture, indicating a competitive inhibition mechanism for PA-50. ELISA detection of toxin A after 100-fold excess protection of PA-50 confirmed that inhibition of the toxin by PA-50 occurs through the prevention of toxin internalization and subsequent cytotoxicity.
The antibodies of the invention further include isolated antibodies that specifically bind to C. difficile toxin B and that competitively inhibit or cross-compete for the specific binding to C. difficile toxin B of an isolated monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9693 or PTA-9692. The antibodies further include isolated antibodies that specifically bind to C. difficile toxin B and that specifically bind to an epitope on C. difficile toxin B defined by the binding of an isolated monoclonal antibody produced by the hybridoma cell line deposited under the ATCC Accession No. PTA-9693 or PTA-9692. In some embodiments, the epitope resides in the tcdB N-terminal enzyme domain. In some of these modalities, antibodies competitively inhibit or cross-compete for binding of PA-41 with tcdB. In other embodiments, the epitope resides in the translocation domain, for example, amino acids 850-1330 of tcdB. In some of these modalities, antibodies competitively inhibit or cross-compete for the binding of PA-39 with tcdB.
51/183
Experiments using toxin B enzyme proteolysis (caspase 1) to assess the specificity of C. difficile anti-toxin B monoclonal antibodies of the invention were performed as described in Example 6. It was shown that mAb PA-41 (PTA-9693) recognizes fragments approximately 103 kDa and 63 kDa, which are derived from the N-terminal enzyme domain of toxin B. Analysis of the N-terminal sequence of the major digestion fragments confirmed this analysis. It has been shown that mAb PA-41 binds to a single epitope within the toxin B N-terminal enzyme domain, distinct from a ιοί 0 xin B receptor binding C-terminal domain linked by a human anti-toxin B antibody (7 ). As described in Examples 6 and 7 here and shown in Figs. 19 and 31E and F, the Biacore assays support a single binding site on toxin B for PA-41. Western blot detection of enzymatically digested toxin B shows that PA-41 binds to a different region on toxin B that is different from that bound by the mAb ”15 CDB-1 comparator. The in vitro activity of PA-41 in the toxin potency assay shows changes both in EC ₅₀ and in maximum percent inhibition as more toxin B is added to the culture, indicating a mixed competitive inhibition mechanism of PA-41.
The antibodies provided here include monoclonal antibodies 20 produced by hybridomas that have been deposited and given the following Patent Deposit Designations: PTA-9692 (for PA-39), PTA-9693 (for PA-41), PTA-9694 (for PA-50) and PTA-9888 (for PA-38). These hybridomas were deposited in accordance with and in compliance with the requirements of the Budapest Treaty on International Recognition of the Microorganism Deposit for the purposes of Patent Procedure in the American Type Culture Collection (ATCC), PO Box 1549, Manassas, VA 20108 USA, as an International Deposit Authority, on January 6, 2009 (for PTA-9692, PTA-9693, PTA-9694) and on March 24, 2009 (for PTA-9888) and received the mentioned Pa30 Deposit Designations try previously. As used here, both deposited hybridomas and monoclonal antibodies produced by hybridomas can be referred to by the same ATCC Deposit Designations or
52/183 by the numbers found within the ATCC Deposit Designations. For example, PTA-9888 or 9888 can be used to refer to the deposited hybridoma or the monoclonal antibody produced by the hybridoma. Consequently, the names of the monoclonal antibodies described here can be used interchangeably with the names of the hybridomas that produce them. It will be apparent to one skilled in the art when the name is intended to refer to the antibody or the hybridoma that produces the antibody. Fragments that bind to antigens provided herein include fragments that bind to antigens from the deposited antibodies mentioned above.
The antibodies of the invention exhibit a number of beneficial characteristics. For example, anti-toxin A antibodies neutralize or inhibit toxin A toxicity both in vitro and in vivo. In in vitro neutralization studies using IMR-90 cells, humanized PA-39 and humanized PA-41 demonstrated neutralization potencies (ie EC ₅₀ values) of 46 pM against toxin A in cells and 5 pM against toxin B , respectively, in these cells. When compared with values reported in the literature for neutralization by human anti-toxin A and anti-toxin B monoclonal antibodies (WO / 2006/121422; US2005 / 0287150; Babcock et al., Infect. Immun., 2006), (7), the value of neutralization of EC ₅ o of 46 pM of hPA-39 appeared to be greater than that reported for human anti-toxin A mAb and the value of EC ₅ o of 5 pM of hPA-41 appeared to be greater than that reported for human anti-toxin B mAb . Consequently, in the studies described here, humanized C. difficile anti-toxin A and C. difficile anti-toxin B monoclonal antibodies of the invention, in particular, humanized forms of these monoclonal antibodies, show improved anti-toxin neutralization characteristics compared to those of other anti-toxin antibodies that have been reported.
In one embodiment, an anti-toxin A antibody of the invention neutralizes or inhibits the in vivo toxicity of C. difficile toxin A in an efficient dose. In another embodiment, anti-toxin B antibodies neutralize or inhibit toxin B in vivo toxicity. In one embodiment, an effective dose
53/183 aware of one or more antitoxin A antibodies of the invention is provided to an individual infected with C. difficile. In one embodiment, an efficient dose of one or more anti-toxin A antibodies of the invention is provided in combination with an efficient dose of one or more anti-toxin B antibodies of the invention to an individual infected with C. difficile. In one embodiment, an anti-toxin A antibody of the invention in a 1: 1 combination with an anti-toxin B antibody of the invention is provided as an efficient dose to an individual infected with C. difficile. In one embodiment, an efficient dose of an anti-toxin A antibody and an anti-toxin B antibody of the invention can be, for example, a combination of 14: 1, 1: 1, 2: 1, 3: 1, 4: 1 etc. antibodies provided to an individual infected with C. difficile. In one embodiment, antibodies are humanized. In one embodiment, antibodies are included in a composition. Illustratively, an effective dose of anti-toxin A and / or anti-toxin B antibodies can vary from 0.1 pg to 1000 milligrams (mg). Antitoxin A antibodies and antitoxin B antibodies or fragments that bind antigens to them can be administered to an individual in an amount of, for example, 0.1 mg / kg-150 mg / kg; in an amount of 0.5 mg / kg-75 mg / kg; in an amount of 1 mg / kg-100 mg / kg; in an amount of 1 mg / kg-50 mg / kg; in an amount of 2 mg / kg-40 mg / kg; in an amount of 2 mg / kg-50 mg / kg; in an amount of 5 mg / kg -50 mg / kg; in an amount of 5 mg / kg-25 mg / kg; in an amount of 10 mg / kg-40 mg / kg; in an amount of 10 mg / kg-50 mg / kg; in an amount of 10 mg / kg-25 mg / kg; or in an amount of 15 mg / kg-50 mg / kg. In one embodiment, the amounts mentioned above may comprise the variable proportions of anti-toxin A antibody and anti-toxin B antibody provided in combination.
As used here, neutralize refers to the reduction, inhibition, block, improvement or elimination of adverse effect (s) of the toxin (s) with which the antibody (s) ( s) specifically binds (m). Neutralization of the adverse effect (s) of the toxin (s) includes 1) delay, reduction, inhibition or prevention of the onset or progression of infection caused by C. difficile or diarrhea or disease associated with C. difficile , 2) increased survival of
54/183 an individual when compared to the average survival of individuals who have not been treated with the antibody (s) and who have infection caused by C. difficile or disease associated with C. difficile, 3) elimination of one or more adverse symptoms or effects or reduced severity of one or more symptoms or adverse effects associated with C. difficile infection or diarrhea or C. difficile-associated disease, 4) allowing the repopulation of the normal microflora of the gastrointestinal tract of individuals who are or were infected with C. difficile, 5) preventing the recurrence of infection caused by C. difficile or disease associated with C. difficile in individuals who were afflicted with infection caused by C. difficile or disease associated with C. difficile, 6) by taking a cure rate of at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% in individuals who have C. difficile infection or C. associated disease difficile and / or 7) preventing death from CDAD or other adverse events associated with C. difficile infection.
The anti-toxin A and C. difficile toxin B antibodies of the invention can be used to treat a number of species of individuals, including humans and other non-human animals (mammals). Subjects that can be treated according to the invention include humans, non-human primates, dogs, cats, mice, rats, hamsters, guinea pigs, cattle, goats, sheep, pigs, horses and the like. Human individuals can also be referred to as patients or individuals here. In particular, individuals include a human patient who has an infection caused by C. difficile or a disease associated with C. difficile. Such human patients include those who are elderly or immunologically impaired.
According to the invention, C. difficile anti-toxin A and toxin B antibodies can resolve the disease caused by C. difficile and increase an individual's survival. In one embodiment, one or more anti-toxin A antibodies and / or one or more anti-toxin B antibodies, when administered to an individual, improve the survival of the individual compared to the average survival of individuals who have not been treated with the
55/183 antibody (s) and which have infection caused by C. difficile or disease associated with C. difficile.
In some embodiments, the dose or amount of one or more anti-toxin A or anti-toxin B antibodies may vary, for example, from 0.2 pg-250 pg or from 2 pg-50 pg or from 5 pg -50 pg, for example , based on in vivo mouse studies. In some embodiments, the dose or amount of one or more anti-toxin A or anti-toxin B antibodies, and in particular a combination of an anti-toxin A antibody and an anti-toxin B antibody, can vary for example from 2 mg / kg-40 mg / kg, 2 mg / kg-50 mg / kg, 5 mg / kg-40 mg / kg, 5 mg / kg-50 mg / kg, 10 mg / kg-40 mg / kg or 10 mg / kg-50 mg / kg, for example, based on studies in hamster in vivo.
As another example, the antibodies of the invention can effect a cure or survival rate of at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97% or 99%. As another example, antibodies can effect a 100% cure or survival rate. In one embodiment, one or more anti-toxin A antibodies, when administered to an individual, together with one or more anti-toxin B antibodies, effect a cure or survival rate of 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100%. As used here, cure rate refers to the percentage of individuals that a doctor could determine who no longer has the infection or disease of a population of individuals with the infection or disease who received administration of one or more antibodies or a or more compositions thereof, of the invention. Survival rate, as used herein, refers to the percentage of individuals who survive for a desired period of time from a population of individuals who have received administration of one or more antibodies or one or more compositions thereof, of the invention. Examples of such desired time periods are provided elsewhere here.
The anti-toxin A and anti-toxin B antibodies provided by the invention can allow the restoration of normal intestinal flora in an individual infected with C. difficile. In this way, such antibodies can resolve
56/183 disease in patients undergoing treatment. The anti-toxin A and anti-toxin B antibodies of the invention can also demonstrate benefits in pharmacokinetics in vivo. The anti-toxin A and anti-toxin B antibodies of the invention can also provide long-term or long-term therapy to an individual who has been infected with C. difficile. As used here, long term refers to therapy that results in an absence of infection caused by C. difficile or disease associated with C. difficile one month or more after treatment is stopped. Preferably, the therapy results in an absence of infection caused by C. difficile or disease associated with C. difficile for two or more months. In some embodiments, the mAbs therapy of the invention results in the treatment or weakening of the active infection caused by C. difficile and the reduction or decrease in the strength of the infection. In other embodiments, the therapy provided by the invention results in an absence of infection caused by C. difficile or disease associated with C. difficile in an individual for 1, 2, 3, 4, 5 or 6 months. In other embodiments, the therapy provided by the invention results in an absence of infection caused by C. difficile or disease associated with C. difficile in an individual for more than 6 months. The anti-toxin A and anti-toxin B antibodies of the invention can prevent the recurrence of infection caused by C. difficile and / or disease associated with C. difficile.
The recurrent nature of CDAD is exacerbated by the emergence of hypervirulent BI / NAP1 / 027 strains that have been found to be resistant to two of the newer antibiotics of the latter case, levofloxacin and moxifloxacin. Such strains triggered outbreaks of increased frequency across the U.S., Canada and Western Europe. The hypervirulent strains comprise a group of closely related isolates characterized as North American Pulsed Field Type 1 (NAP1), restriction enzyme type BI analysis and PCR Ribotype 027 collectively known as BI / NAP1 / 027 (5). The hypervirulence of the BI / NAP1 / 027 strains was attributed at least in part to the increased production of toxins A and B, two virulence factors of CDAD (6). BI / NAP1 / 027 isolates produce 16-23 times higher levels of toxins A and B than other strains (6). Apparent fitness
57/183 of these strains creates the threat of spacing around the world, underscoring the potential of antibiotic treatment for other diseases, as well as increased recurrence rates and the severity of CDAD. Although antibiotics are in development for the treatment of CDAD, such as nitazoxanide, rifaximin, ramosplanin and fidaxomycin, clinical isolates of C. difficile that are resistant to rifaximin have been reported. In a recently completed phase 3 test (91), fidaxomicin significantly reduced the overall CDAD recurrence rate compared to vancomycin, but not for the BI / NAP1 / 027 strains. Outbreaks of hypervirulent BI / NAP1 / 027 strains led to increased hospital stays, treatment failures, frequency of recurrence and mortality rates (3). The new mAbs developed and described here provide new therapies to combat the increasing incidence and severity of CDAD.
In one embodiment, the mAbs of the invention are used to treat infection caused by various strains of C. difficile. In one embodiment, strains of C. difficile are highly infectious and their toxins are neutralized by the mAbs of the invention. In one embodiment, toxins from C. difficile hypervirulent strains, including BI / NAP1 / 027, are neutralized by the mAbs of the invention. In one embodiment, the mAbs of the invention provide therapeutic effects in neutralizing toxins from a wide range of clinical toxigenic isolates, including strains of isolates from outpatients. Preferably, mAbs neutralize toxins from hypervirulent isolates, such as BI / NAP1 / 027 and at least 90% or more of other clinically relevant C. difficile isolates. In particular and as illustrated in Example 8 here, it has been shown that the mAbs of the invention significantly neutralize the toxicity / activity of nineteen different clinical isolates of C. difficile, including BI / NAP1 / 027 and other hypervirulent strains of C. difficile, for example , CCL676, HMC553, Pitt45, CD196, Montreal 5 and Montreal 7.1. According to the invention, antibodies are provided which neutralize toxin A and toxin B of C. difficile hypervirulent strains, for example, without limitation, which are determined by a value
58/183 EC ₅ o ranging from 7.7 ^'12 M to 4.8' ⁸ M for antitoxin A mAbs and an EC ₅₀ value ranging from 1, T ¹¹ M to 6.5 ^'10 M for an antitoxin mAb B. In addition, the mAbs of the invention are provided for use in neutralizing hypervirulent strains of C. difficile, including hospital-derived and non-hospital isolates, as a treatment for infection caused by C. difficile and related diseases.
In other modalities and as a non-limiting example, the mAbs of the invention exhibit a neutralization value of EC ₅ o in the range of 93 pM-30 nM or an EC ₅₀ of 46 pM, for neutralization of toxin A and an EC50 value in range of 4 pM-9.5 pM or an EC ₅ o of 5 pM, for neutralizing toxin B depending on the in vitro cell-based assay employed. As described in Example 3 here, in an assay comprising CHO-K1 cells in which 8 pg / ml of toxin A were used, the antitoxin A mAbs of the invention exhibited an EC50 value of 93 pM. In an assay comprising CHO-K1 cells in which 8 pg / ml of toxin B were used, the antitoxin B mAb of the invention exhibited an EC50 value of 9.2 pM. In an assay comprising T-84 cells in which 240 ng / ml of toxin A were used, the antitoxin A mAbs of the invention exhibited EC ₅₀ values of 146 pM and 175 pM. In a Caco-2 cell-based assay, the antitoxin A mAbs of the invention neutralized toxin A toxicity at ECsode levels of 196 pM and 485 pM. In the red blood cell hemagglutination assay in which 8 pg / ml of toxin A was used, the antitoxin A mAbs of the invention had an EC50 neutralization value of 1.8 nM and 30 nM to prevent RBC hemagglutination.
The antibodies of the invention can have any, a combination of, or all, the features mentioned above.
As described in the Examples here, the mAbs of the invention demonstrate superior toxin neutralizing potency both in vitro and in vivo in the best available preclinical models of CDAD. In addition, the mAbs of the invention demonstrate uniquely broad and potent neutralization of toxins from various BI / NAP1 / 027 strains. In addition, such mAbs have demonstrated complete and durable protection from mortality in a model
59/183 of highly rigorous hamster CDAD. These results support the ability of the invention's mAbs to efficiently and effectively block the pathogenic effects of the C. difficiles toxin in a way that allows the colon to heal, normal intestinal microflora to heal, and CDAD and / or disease. infection caused by C. difficile is resolved.
In one embodiment, antibodies to toxin A include those that competitively inhibit or cross-compete for the specific binding to C. difficile toxin A of an isolated monoclonal antibody produced by the hybridoma cell line deposited under Nos.
ATCC Access Code PTA-9692, PTA-9694 or PTA-9888. Preferred antibodies to toxin B include those that competitively inhibit or cross-compete for the specific binding to C. difficile toxin B of an isolated monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA- 9693 or
PTA-9692. In some embodiments, antibodies include those that competitively inhibit or cross-compete for the specific binding to C. difficile toxin A of an isolated monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9692 , PTA-9694 or PTA-9888 and competitively inhibit or cross-compete for the specific binding to C. difficile toxin B of an isolated monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9693 or PTA-9692. All modalities also include humanized forms of the antibodies previously described under Nos. ATCC Access
PTA-9692, PTA-9694, PTA-9888 or PTA-9693.
To determine competitive inhibition or cross-linking competition, a variety of assays known to a person skilled in the art can be employed. For example, cross-competition assays can be used to determine whether an antibody competitively inhibits binding to toxin A and / or toxin B by another antibody. Such methods can be cell-based methods that employ flow cytometry or solid phase binding analysis. Other tests that assess the capacity
60/183 of antibodies cross-competing for binding to toxin A and / or toxin B in solid phase or in solution phase can also be used. Examples of antibodies or fragments that bind to antigens within the scope of the invention include those that competitively inhibit specific binding by at least approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80 %, 90%, 95% or 99%. Inhibition can be evaluated in various molar ratios or mass ratios; for example, competitive binding experiments can be performed with a molar excess of 2 times, 3 times, 4 times, 5 times, 7 times, 10 times or more of the first antibody over the second antibody.
Other antibodies covered by the invention include those that specifically bind to an epitope on C. difficile toxin A defined by the binding of an isolated monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9692, PTA -9694 or PTA-9888. Still other antibodies or fragments that bind to antigens covered by the invention include those that specifically bind to an epitope on C. difficile toxin B defined by the binding of an isolated monoclonal antibody produced by the hybridoma cell line deposited under the No. Access from ATCC PTA-9693 or PTA-9692. Still other antibodies or fragments that bind to antigens covered by the invention include those that specifically bind to an epitope on C. difficile toxin A defined by the binding of an isolated monoclonal antibody produced by the hybridoma cell line deposited under No. ATCC Accession PTA-9692, PTA-9694 or PTA-9888 and specifically bind to an epitope on C. difficile toxin B defined by the binding of an isolated monoclonal antibody produced by the hybridoma cell line deposited under the Accession No. ATCC PTA-9693 or PTA-9692.
To determine an epitope, standardized epitope mapping methods known in the art can be used. For example, fragments (peptides) of the toxin (preferably synthetic peptides) that bind an antibody can be used to determine whether an anti
61/183 candidate body or an antigen-binding fragment of it binds to the same epitope. For linear epitopes, overlapping peptides of a defined length (for example, 8 or more amino acids) are synthesized. The peptides are preferably compensated by 1 amino acid, so that a series of peptides covering each fragment of 8 amino acids of the toxin sequence is prepared. Fewer peptides can be prepared using larger offsets, for example, 2 or 3 amino acids. In addition, longer peptides (for example, 9-, 10- or 11-mers) can be synthesized. Peptide binding to antibodies can be determined using standardized methodologies including surface plasmon resonance (eg, Biacore) and ELISA assays. For the verification of the conformational epitopes, to which the antibodies provided here can, in some modalities, bind, larger peptide fragments can be used. Other methods that use mass spectrometry to define conformational epitopes have been described and can be used (see, for example, Baerga-Ortiz et al., Protein Science 11: 1300-1308, 2002 and references cited here). Still other methods for determining epitopes are provided in standard laboratory reference works, such as Unit 6.8 (Phage Display Selection and Analysis of B-cell Epitopes) and Unit 9.8 (Identification of Antigenic Determinants Using Synthetic Peptide Combinatorial Libraries) from Current Protocols in Immunology, Coligan et al., Eds., John Wiley & Sons. Epitopes can be confirmed by introducing one or more mutations or point deletions within a known epitope and then testing for binding with one or more antibodies to determine which mutations reduce antibody binding.
Antibodies or fragments that bind to antigens provided by the invention can specifically bind toxin A and / or toxin B with subnanomolar affinity. Antibodies or fragments that bind to antigens may have binding affinities of approximately 1 x 10 ' ⁹ M or less, approximately 1 x 10' ¹ ° M or less or approximately 1 x ^{10 '11} M or less. In a particular modality, the affinity of
62/183 bond is less than approximately 5 x 10 ' ¹ ° M.
Antibodies or fragments that bind to antigens can have a constant velocity on (Kon) to toxin A or toxin B of at least 10 ² M ' ¹ s'¹; at least 10 ³ M ' ¹ s'¹; at least 10 ⁴ M ' ¹ s'¹; at least 10 ⁵ M ' ¹ s'¹; at least 10 ⁶ M ' ¹ s'¹; or at least 10 ⁷ M ' ¹ s' ¹ , which is measured by surface plasmon resonance. Antibodies or fragments that bind to antigens may have a constant velocity speed off (Koff) to toxin A or toxin B of a maximum of 10 ' ³ s'¹; at most 10 ^ s'¹; maximum 10 ' ⁵ s'¹; or at most 10 ^ s' ¹ , which is measured by surface plasmon resonance. Antibodies or fragments that bind to antigens can have a dissociation constant (K _D ) to toxin A or toxin B of a maximum of 10 ' ⁷ M; maximum 10 ' ⁸ M; maximum 10 ' ⁹ M; maximum 10 ' ¹ ° M; maximum 10 ^'11 M; maximum 10 ^'12 M; or at most 10 ^"13 l / l.
As used herein, the terms antibody or immunoglobulin include glycoproteins that comprise at least two heavy polypeptide chains (H) and light polypeptide chains (L) interconnected by disulfide bonds. Each heavy chain is comprised of a variable heavy chain region (abbreviated here as HCVR or V _H ) and a heavy chain constant region (C _H ). The heavy chain constant region is comprised of three domains, CH1, CH2 and CH3. Each light chain is comprised of a light chain variable region (abbreviated here as LCVR or V _L ) and a light chain constant region (C _L ). The light chain constant region is comprised of a domain, C _L. The V _H and VL regions can be further subdivided into regions of hypervariability, called complementarity determination regions (CDRs), interspersed with regions that are more conserved, called structural regions (FRs). Each V _H and V _L is composed of three CDRs and four FRs, arranged from the amino terminal to the carboxy terminal in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. Together, the variable regions of the heavy and light chain polypeptides contain or form a binding domain that interacts with / binds to an antigen. The antibody constant regions can
63/183 mediate the binding of immunoglobulin with tissues or host factors, including various cells of the immune system (for example, effector cells) and the first component (C1q) of the classic complement system.
The invention further provides other forms of antibodies, such as isolated chain antibodies, recombinantly produced antibodies, bispecific, heterospecific or multimeric antibodies, dianibody etc., as further described herein.
The term antigen binding fragment of an antibody as used herein, refers to one or more portions of an antibody that maintain the ability to specifically bind to an antigen (for example, toxin A, toxin B, toxin A and toxin B, etc.) or to epitopic regions of an antigen. It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody. In one embodiment, the monoclonal antibody fragments function in a similar manner to the corresponding intact monoclonal antibodies. In one embodiment, the monoclonal antibody fragments cross-react with the corresponding intact monoclonal antibodies. In one embodiment, the monoclonal antibody fragments can be used interchangeably with the corresponding intact monoclonal antibodies. Examples of binding fragments falling within the term antigen binding fragment of an antibody include (i) a Fab fragment, a monovalent fragment consisting of the V _L , V _H , C _L and C _H 1 domains; (ü) an F (ab ') ₂ fragment, a divalent fragment comprising two Fab fragments linked by a disulfide bridge in the fold region; (iii) an Fd fragment consisting of the V _H and CH1 domains; (iv) an Fv fragment consisting of the V _L and V _H domains of a single arm of an antibody, (v) a dAb fragment (Ward et al., (1989) Nature 341: 544-546) consisting of a domain V _H ; and (vi) an isolated complementarity determination region (CDR). Furthermore, although the two domains of the Fv fragment, Vi. and V _H , are encoded by separate genes, they can bind, using recombinant methods, through a synthetic ligand that allows them to be made in the
64/183 ma of a single protein chain in which the V _L and V H region pair form monovalent molecules (known as isolated chain Fv (scFv); see, for example, Bird et al. (1988) Science 242: 423 -426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85: 5879-5883). Such isolated chain antibodies are also intended to be encompassed within the term antigen binding fragment of an antibody. These antibody fragments are obtained using conventional procedures, such as proteolytic fragmentation procedures, as described in J. Goding, Monoclonal Antibodies: Principles and Practice, pp 98-118 (NY Academic Press 1983), which is incorporated here by reference, as well as by other techniques known to those skilled in the art. The fragments are checked for activity or utility in the same way as intact antibodies.
In one embodiment, the Fab mAbs fragments of the invention were generated and tested for their neutralizing activity in cell-based assays, as described in Example 10 here. Thus, antibody fragments, such as Fab fragments, from the mAbs of the invention can also be used to bind and neutralize toxin A and / or toxin B from C. difficile.
An isolated antibody, as used herein, is intended to refer to an antibody that is substantially free of other antibodies that have different antigen specificities (for example, an isolated antibody that specifically binds toxin A is substantially free of antibodies that bind specifically to antigens other than toxin A). An isolated antibody that specifically binds to an epitope, isoform or variant of toxin A or toxin B, however, generally has cross-reactivity with other related antigens, for example, from other strains of C. difficile. In addition, an isolated antibody that specifically binds to an epitope, isoform, or toxin A variant can also specifically bind to toxin B, and an isolated antibody that specifically binds to an epitope, isoform, or toxin B variant can also bind specifically to toxin A. In some modalities, however, the anti
65/183 isolated body or antigen-binding fragment thereof that specifically binds to an epitope, isoform or toxin A variant also does not specifically bind to toxin B. Still in other embodiments, the isolated antibody or binding fragment the antigen thereof that specifically binds to an epitope, isoform or variant of toxin B also does not specifically bind to toxin A. In addition, an isolated antibody may be substantially free of other cellular material and / or chemical agents. Antibodies that are substantially free of other antibodies that have different antigen specificities or other materials and / or chemical agents and / or proteins can be isolated and / or purified antibodies. Antibodies can be purified by methods commonly performed by those skilled in the art, for example, affinity chromatography, Protein A chromatography and the like. As used herein, specific binding refers to the binding of the antibody to a predetermined or cognate antigen. Typically, the antibody binds with an affinity that is at least twice as high as its affinity for binding to a non-specific antigen (eg, BSA, casein) other than the predetermined antigen or a closely related antigen. In one embodiment, an antibody of the invention can bind to a linear epitope of the target antigen, for example, toxin A and / or toxin B. In one embodiment, an antibody of the invention can bind to a conformational epitope of the target antigen, for example. example, toxin A and / or toxin B.
The isolated antibodies of the invention encompass several antibody heavy and light chain isotypes (immunoglobulin), such as the heavy chain or isotypes lgG1, lgG2, lgG3, lgG4, IgM, lgA1, lgA2, IgAsec, IgD, IgE and subtypes of same, for example, lgG2a, lgG2b; and the light chain isotypes κ and λ and its subtypes. In one embodiment, the isolated antibodies are either the lgG2a or lgG1 κ isotype. As used herein, isotype _ether and _re f to the antibody class (e.g., IgM or IgG1 or Λ1) which is encoded by constant region genes of heavy and light chain. The antibodies or fragments that bind to the antigens on them may be full-length or may include only a fragment of ly
66/183 antigen, such as the constant and / or variable domain of the lgG1, lgG2, lgG3, lgG4, IgM, IgAI, lgA2, IgAsec, IgD or IgE antibody, or can consist of a Fab fragment, an F ( ab ') ₂ and an Fv fragment.
The antibodies of the present invention can be polyclonal, monoclonal or a mixture of polyclonal and monoclonal antibodies. Antibodies can be produced by a variety of techniques well known in the art. Procedures for producing polyclonal antibodies are well known. As a non-limiting example, polyclonal antibodies are produced by administering the toxin A and / or toxin B protein subcutaneously to white New Zealand rabbits who first had their blood drawn to obtain preimmune serum. Toxin A and / or toxin B can be injected in a total volume of 100 µl per site at six different sites, typically with one or more adjuvants. Blood was then drawn from the rabbits two weeks after the first injection and periodically boosted with the same antigen three times every six weeks. A serum sample is collected 10 days after each boost. Polyclonal antibodies are recovered from the serum, preferably by affinity chromatography using toxin A and / or toxin B to capture the antibody. This and other procedures for the production of polyclonal antibodies are described in Harlow, E. and Lane, D., Eds., Antibodies: A Laboratory Manual (1988), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, whose content is incorporated here as a reference.
The production of the monoclonal antibody can be accomplished using techniques that are also well known in the art. The term monoclonal antibody, as used herein, refers to a preparation of antibody molecules of a single molecular composition. A monoclonal antibody exhibits a unique binding and affinity specificity for a particular epitope of a certain antigen or immunogenic agent. The monoclonal antibody production process involves obtaining immune somatic cells with the potential to produce antibodies, in particular B lymphocytes, which have previously been immunized with the antigen of interest in vivo or in vitro or both and which are suitable for fusion with a lineage of mie
67/183 cell B cell. Monoclonal antibodies can be produced using immune cells and myeloma cells of different species, such as murine and human cells and cell lines or for example, in strains of mice that have been genetically engineered to carry a human immune system, as further described below.
Although monoclonal antibodies directed against toxin A and toxin B were typically produced by immunizing animals with toxoids (inactive forms of toxin A and toxin B) and / or with inactive fragments of these toxins, the mAbs of the present invention were generated by planning and employing a new immunization strategy. According to the invention, the mAbs described here and deposited were produced by immunizing animals with toxoid, followed by reinforcement of animals with the active (non-toxoid) form of toxin A and / or toxin B (see Example 1 here ). Booster with the active form of toxin A or toxin B served to identify such immunized animals that had developed protective antibodies solely by virtue of the new immunization schedule. Without wishing to be bound by theory, the booster regimen with toxin A and / or active toxin B was more highly immunogenic in recipient animals. Such animals that tolerated increasing booster doses of active toxin A or toxin B, which are typically lethal to naive animals, produced highly efficient neutralizing antibodies, which protected these animals and contributed to their survival despite receiving active toxin. The production of hybridomas from animals that mounted an efficient immune response against toxin A or toxin B provided highly potent monoclonal antibodies anti-toxin A and anti-toxin B, which provide a high level of protection both in vitro and in vivo. In the production of antibodies, including polyclonal and monoclonal antibodies, adjuvants can be used. Non-limiting examples of adjuvants that are suitable for use include Freund's incomplete adjuvant, aluminum phosphate, aluminum hydroxide, Ribi (i.e., monophosphoryl lipid A, trehalose dimicolate, Mycobacter cell wall skeleton
68/183 ria and Tween® 80, with 2% squalene), saponins, Quil A or alum. A cytotoxic T lymphocyte (CTL) response can be initiated by conjugating toxins (or fragments, inactive derivatives or analogues thereof) with lipids, such as, for example, tripalmitoyl-S-glycerylcysteinyl-serine-serine.
In other embodiments, additional immunization methods can be used to generate monoclonal antibodies directed against toxin A and / or toxin B. For example, in vivo immunization of animals (for example, mice) can be performed with the desired type and the amount of protein or polypeptide, for example, toxoid or toxin. Such immunizations are repeated when necessary at intervals of up to several weeks to obtain a sufficient antibody titer. Once immunized, animals can be used as a source of antibody-producing lymphocytes. After the last antigen boost, the animals were sacrificed and the spleen cells were removed. Mouse lymphocytes provide a higher percentage of suitable fusions with the mouse myeloma strains described here. Of these, the BALB / c mouse strain is suitable. However, other strains of mice, rabbits, hamsters, sheep, goats and frogs can also be used as hosts for the preparation of antibody-producing cells. To see; Goding (in Monoclonal Antibodies: Principles and Practice, 2- ed., Pp. 60-61, Orlando, Fla., Academic Press, 1986). In particular, strains of mice that have human immunoglobulin genes inserted into the genome (and that cannot produce immunoglobulins from mice) can be used. Examples include the HumAb mouse strains produced by Medarex (now Bristol Myers Squibb) / GenPharm International and the mouse XenoStrains produced by Abgenix. Such mice produce fully human immunoglobulin molecules in response to immunization.
Such antibody-producing cells that are in the dividing plasmablast stage fuse preferentially. Somatic cells can be obtained, for example, lymph nodes, spleens and blood
69/183 peripheral animals initiated with antigen and the lymphatic cells of choice depend to a great extent on their empirical usefulness in a particular fusion system. The lymphocytes that secrete antibody are then fused with B-cell myeloma cells (mouse) or cells
5. transformed, which are able to replicate indefinitely in cell culture, thus producing a cell line that secretes immortal immunoglobulin. The resulting fused cells or hybridomas are cultured and the resulting colonies are checked for the production of the desired monoclonal antibodies. Colonies that produce such antibodies are cloned, subcloned and grown in vivo (in the form of ascites) or in vitro to produce large amounts of antibody. Descriptions of hybridoma methodology and technology can be found in Kohler and Milstein, Nature 256: 495 (1975) or Harlow, E. and Lane, D., Eds., Antibodies: A Laboratory Manual (1988), Cold Spring Harbor Laboratory Press , Cold S15 pring Harbor, NY, which are hereby incorporated by reference.
Alternatively, human somatic cells capable of producing antibody, specifically B lymphocytes, are suitable for fusion with myeloma cell lines. Although spleen B lymphocytes, tonsils or lymph nodes submitted to an individual's biopsy can be used, 20 the most easily accessible peripheral blood B lymphocytes (PBLs) are preferred. In addition, human B cells can be directly immortalized by the Epstein-Barr virus (Cole et al., 1995, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Although somatic cell hybridization procedures are preferred, in principle, other techniques for producing monoclonal antibodies can be employed, such as transformation of viral or oncogenic B lymphocytes.
The myeloma cell lines suitable for use in fusion procedures that produce hybridomas preferably are non-antibody producing, have high fusion efficiency and enzyme deficiencies that render them unable to grow in certain selective media that support the growth of the desired hybridomas. Examples of such myeloma cell lines that can be used for
70/183 production of fused cell lines includes P3-X63 / Ag8, X63-Ag8,653, NS1 / 1.Ag 4,1, Sp2 / 0-Ag14, FO, NSO / U, MPC-11, MPC11-X45 -GTG 1,7, S194 / 5XX0 Bul, derived from mice; R210.RCY3, Y3-Ag 1.2.3, IR983F and 4B210 derived from rats; and U-266, GM1500-GRG2, LICR-LON-HMy2, UC729-6, derived from humans (Goding, in Monoclonal Antibodies: Principles and Practice, 2- ed., pp. 65-66, Orlando, Fla., Academic Press, 1986; Campbell, in Monoclonal Antibody Technology, Laboratory Techniques in Biochemistry and Molecular Biology Vol. 13, Burden and Von Knippenberg, eds. Pp. 75-83, Amsterdam, Elseview, 1984).
Fusion with mammalian myeloma cells or other fusion partners capable of replicating indefinitely in cell culture is carried out using standard and well-known techniques, for example, using polyethylene glycol (PEG) or other agents fusion (See Milstein and Kohler, Eur. J. Immunol. 6: 511 (1976), which is incorporated herein by reference).
In other embodiments, the antibodies can be recombinant antibodies. The term recombinant antibody, as used herein, is intended to include antibodies that are prepared, expressed, raised or isolated by recombinant means, such as antibodies isolated from an animal (for example, a mouse) that is transgenic to immunoglobulin genes of other species, antibodies expressed using a recombinant expression vector transfected in a host cell, antibodies isolated from a recombinant combinatorial antibody library, or antibodies prepared, expressed, raised or isolated by any other means that involves the processing of immunoglobulin gene sequences in other DNA sequences.
In yet other embodiments, the antibodies can be chimeric or humanized antibodies. As used herein, the term chimeric antibody refers to an antibody that combines a murine immunoglobulin (Ig) variable or hypervariable regions with a human Ig constant region or constant and structural variable regions. In some fashion
71/183, the chimeric antibody comprises the variable region of any of the deposited antibodies provided here and a human constant region. In some embodiments, the human constant region is a human IgG constant region, such as a human IgG1 constant region. Chimeric antibodies can be produced by the method provided below in the Examples or by any method known to those skilled in the art. As used herein, the term humanized antibody refers to an antibody that substantially maintains only the antigen binding CDRs of the parent antibody, for example, murine monoclonal antibody, in association with human framework regions (see, for example, Waldmann, 1991 , Science 252: 1657). Such chimeric or humanized antibodies, which maintain the binding specificity of the murine antibody, but have constant / structural regions of human Ig, are expected to have reduced immunogenicity when administered in vivo. Therefore, chimeric and humanized antibodies preferentially maintain the toxin neutralization activities of the provided monoclonal antibodies and are suitable for repeated dosing (for example, in humans). A person skilled in the art can use known methods (for example, in vitro cell-based assays) to compare the activity of humanized antibodies to the deposited monoclonal antibodies provided here and to determine whether or not humanized antibodies treat and / or prevent recurrence. of an established infection caused by C. difficile. A person skilled in the art can also use the methods described here including the hamster model of C. difficile infection described below.
The sequences of the humanized mAbs can be planned using the illustrative non-limiting method below. First, the structural amino acid residues important to the structure of the CDR are identified. In parallel, human VH and VL sequences that have high homology to murine VH and VL, respectively, are selected from known human immunoglobulin (germline) sequences. The CDR sequences of the murine mAb, together with structural amino acid residues important for maintaining the structure of the CDRs, are en
72/183 xerted within the selected human structural sequences. In addition, human structural amino acid residues that are observed to be atypical in the corresponding V region subgroup are replaced with typical residues to reduce the potential immunogenicity of the resulting humanized mAb. These human VH and VL regions are cloned into the expression vectors, for example, pCON Gamal and pCON kappa (Lonza Biologies, Berkshire, UK), respectively. These vectors encode the constant region (s) of the human immunoglobulin heavy and light chain genes. 293T cells can be transiently transfected with these expression vectors using the Effectene system (Qiagen, Valencia, CA). Cell supernatants containing secreted chimeric mAb can be collected after transfection, for example, after three days and purified using Protein A chromatography. Other expression vectors and host cells can be used to recombinantly produce the described antibodies, as is understood by those skilled in the art.
Other methods for humanizing antibodies or fragments that bind to antigens are well known in the art and include the methods provided, for example, in U.S. Patent Nos. 5,585,089; 5,693,761; 5,693,762; and 6,180,370. The methods for achieving humanization provided in these patents are incorporated here as a reference in their entirety. Antibodies or fragments that bind to humanized antigens according to the methods provided in these patents are also provided here.
In one embodiment, a humanized C. difficile antitoxin A mAb (hmAb) of the invention comprises an immunoglobulin protein or a fragment thereof, which is composed of (i) two heavy polypeptides (H), where each H chain contains a VH region comprising the amino acid sequence that is shown in SEQ ID NO: 1 and a human CH region, for example, a C region of IgG1 and (ii) light polypeptide chains (L), where each L chain contains a VL region comprising the amino acid sequence that is shown in SEQ ID NO: 3 and a human CL region, for example, a k chain C region. In a
73/183 embodiment, a humanized C. difficile antitoxin A mAb of the invention comprises an immunoglobulin protein or a fragment thereof, which is composed of (i) two of heavy polypeptides (H), where each H chain contains a region VH comprising the amino acid sequence that is shown in SEQ ID NO: 2 and a human CH region, for example, a C region of IgG1 and (ii) light polypeptide chains (L), where each L chain contains a region VL comprising the amino acid sequence that is shown in SEQ ID NO: 3 and a human CL region, for example, a k chain C region. In one embodiment, a humanized C. difficile antitoxin A mAb of the invention comprises an immunoglobulin protein that is composed of (i) two of heavy (H) polypeptides, where each H chain contains a VH region comprising the amino acid sequence which is shown in SEQ ID NO: 1 and a human CH region, for example, a C region of lgG1 and (ii) light polypeptide chains (L), where each L chain contains a VL region comprising the amino acid sequence which is shown in SEQ ID NO: 4 and a human CL region, for example, a k chain C region. In one embodiment, a humanized C. difficile antitoxin A mAb of the invention comprises an immunoglobulin protein that is composed of (i) two of heavy (H) polypeptides, where each H chain contains a VH region comprising the amino acid sequence which is shown in SEQ ID NO: 2 and a human CH region, for example, a C region of IgG1 and (ii) light polypeptide chains (L), where each L chain contains a VL region comprising the amino acid sequence which is shown in SEQ ID NO: 4 and a human CL region, for example, a k chain C region. Such humanized C. difficile antitoxin A mAbs contain an hPA-39 mAb of the invention.
In one embodiment, a humanized C. difficile antitoxin A mAb of the invention comprises an immunoglobulin protein that is composed of (i) two heavy polypeptide chains (H), where each H chain contains a VH region comprising the sequence of amino acids that is shown in SEQ ID NO: 5 and a human CH region, for example, a C region of lgG1 and (ii) light polypeptide chains (L), where each
74/183 L chain contains a VL region comprising the amino acid sequence that is shown in SEQ ID NO: 7 and a human CL region, for example, a k chain C region. In one embodiment, a humanized C. difficile antitoxin A mAb of the invention comprises an immunoglobulin protein that is composed of (i) two of heavy (H) polypeptides, where each H chain contains a VH region comprising the amino acid sequence which is shown in SEQ ID NO: 6 and a human CH region, for example, a C region of IgG1 and (ii) light polypeptide chains (L), where each L chain contains a VL region comprising the amino acid sequence which is shown in SEQ ID NO: 7 and a human CL region, for example, a k chain C region. Such humanized C. difficile antitoxin A mAbs contain an hPA-50 mAb of the invention.
In one embodiment, a humanized C. difficile antitoxin B mAb of the invention comprises an immunoglobulin protein that is composed of (i) two of heavy (H) polypeptides, where each H chain contains a VH region comprising the amino acid sequence which is shown in SEQ ID NO: 8 and a human CH region, for example, a C region of IgG1 and (ii) light polypeptide chains (L), where each L chain contains a VL region comprising the amino acid sequence which is shown in SEQ ID NQ: 10 and a human CL region, for example, a k chain C region. In one embodiment, a humanized C. difficile antitoxin B mAb of the invention comprises an immunoglobulin protein that is composed of (i) two heavy polypeptide chains (H), where each H chain contains a VH region comprising the sequence of amino acids that is shown in SEQ ID NO: 9 and a human CH region, for example, a C region of IgG1 and (ii) light polypeptide chains (L), where each L chain contains a VL region comprising the sequence of amino acids that is shown in SEQ ID NO: 10 and a human CL region, for example, a k chain C region. Such humanized C. difficile antitoxin B mAbs contain an hPA-41 mAb of the invention.
The L-chain and H-chain C regions of the previously described humanized antibodies of the invention can comprise the C region of
75/183 human κ L chain (C _L ) and the human lgG1 C chain (C _H ) region that has sequences contained in Genbank Accession No. NW_001838785 and Genbank Accession No. MW_001838121, respectively. In other embodiments, the humanized antibodies comprise a human H chain C region selected from the isotypes lgG2a, lgG2b, lgG3 or lgG4.
In an illustrative embodiment, the invention contains a monoclonal antibody or a fragment thereof, generated against C. difficile toxin A, in which the antibody is composed of two heavy chain polypeptides, each heavy chain containing a VH region and a region Human CH and two heavy chain polypeptides, each light chain containing a human VL region and a human CL region. The nucleic acid (or cDNA) sequence encoding the consecutive amino acid sequence of the polypeptide heavy chain of SEQ ID NO: 14 is shown in SEQ ID NO: 15, (Fig. 38B); the nucleic acid sequence (or cDNA) encoding the consecutive amino acid sequence of the polypeptide light chain of SEQ ID NO: 16 is shown in SEQ ID NO: 17 (Fig. 38A).
In an illustrative embodiment, the invention contains a monoclonal antibody or a fragment thereof, generated against C. difficile toxin A, in which the antibody is composed of two heavy chain polypeptides, each heavy chain containing a VH region and a region Human CH and two heavy chain polypeptides, each light chain containing a human VL region and a human CL region. The nucleic acid sequence (or cDNA) encoding the consecutive amino acid sequence of the polypeptide heavy chain of SEQ ID NO: 18 is shown in SEQ ID NO: 19, (Fig. 39B); the nucleic acid sequence (or cDNA) encoding the consecutive amino acid sequence of the polypeptide light chain of SEQ ID NO: 20 is shown in SEQ ID NO: 21 (Fig. 39A).
In an illustrative embodiment, the invention contains a monoclonal antibody or a fragment thereof, generated against C. difficile toxin B, in which the antibody is composed of two heavy chain polypeptides, each heavy chain containing a VH region and a region Human CH
76/183 and two heavy chain polypeptides, each light chain containing a human VL region and a human CL region. The nucleic acid sequence (or cDNA) encoding the consecutive amino acid sequence of the polypeptide heavy chain of SEQ ID NO: 22 is shown in SEQ ID NO: 23 (Fig. 40B); the nucleic acid sequence (or cDNA) encoding the consecutive amino acid sequence of the polypeptide light chain of SEQ ID NO: 24 is shown in SEQ ID NO: 25 (Fig. 40A).
Also encompassed by the invention are portions or fragments of the humanized C. difficile anti-toxin A and anti-toxin B antibodies described above. Such portions or fragments include the complementarity determining regions (CDRs) of the V regions of both polypeptide H and L chains, which can be conventionally determined by those skilled in the art; F (ab) fragments, F (ab ') fragments, F (ab') 2 fragments, Fc fragments, Fd fragments and the like. In a modality, portions or fragments of humanized antibodies containing V regions or functional portions thereof, will optimally bind to the respective toxin and neutralize the activity of the toxin. In one embodiment, such functional portions or fragments of the humanized antibodies optimally neutralize the activity of the toxin at a level similar to, if not better than, that of the complete humanized antibody.
According to the invention molecularly cloned humanized mAbs directed against C. difficile toxins A or B are provided. Such humanized mAbs were isolated and characterized as described in Example 9, Sections D and E here below. In one embodiment, the light chain constant region (CL) of each of the humanized antibodies is of the kappa class (κ). In one embodiment, the heavy chain (CH) constant region of each of the humanized antibodies is of the lgG1 isotype. In other embodiments, the CH region of the humanized antibodies is of the lgG2a, lgG2b, lgG3, lgG4, IgA, IgE, IgA or IgM isotype. It has been observed that humanized mAbs containing unique variable regions (V) bind and neutralize the activity of toxin A or toxin B of C. difficile. The VL and VH regions of humanized mAbs can be part of a complete immunoglobulin (Ig)
77/183 or an antibody molecule or can be used as portions or fragments of the antibody, in particular, portions or fragments that have binding and / or neutralizing activity. Non-limiting examples of antibody fragments include Fab, F (ab) 2 and F (ab ') or F (ab') 2 fragments. The embodiments of the invention are directed to humanized C. difficile antitoxin A mAbs or fragments thereof , which have activity against C. difficile toxin A, in which the L chain V region is selected from one or more of SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 7. In one embodiment, the invention is directed to CDRs, namely, CDR1, CDR2 and / or CDR3, in the VH or VL regions of the described antibodies. The modalities of the invention are directed to humanized C. difficile antitoxin B mAbs or fragments thereof, which have activity against C. difficile toxin B, in which the V region of the L chain is shown in SEQ ID NO: 10. embodiments of the invention are directed to humanized C. difficile antitoxin A mAbs or fragments thereof, which have activity against C. difficile toxin A, in which the V region of the H chain is selected from one or more of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5 and SEQ ID NO: 6. The modalities of the invention are directed to humanized C. difficile antitoxin B mAbs or fragments thereof, which have activity against C. difficile toxin B, in which the H chain V region is selected from one or more of SEQ ID NO : 8 or SEQ ID NO: 9. It is a modality, the invention is directed to CDRs, namely, CDR1, CDR2 and / or CDR3, in the VH or VL regions of the described antibodies.
In other embodiments, the invention encompasses nucleic acids that encode antigen-binding portions, CDRs or variable (V) regions of the C. difficile anti-toxin A and / or anti-toxin B antibodies of the invention. In various embodiments, the portions, CDRs or V regions are derived from PA-38, PA-39, PA-41 or PA-50 or humanized versions of them, as described here. In additional embodiments, the invention encompasses the amino acid sequence of the antigen binding portions, CDRs or V regions that are encoded by the respective nucleic acids.
According to another modality, monoclonal antibodies from
78/183 the present invention can be modified to be in the form of a bispecific antibody, a bifunctional antibody, a multispecific antibody or a heterofunctional antibody. Non-limiting examples of bispecific and heterospecific antibodies and procedures for producing such antibodies can be found in a number of illustrative publications, for example, UA20090060910, W02009 / 058383, W02009 / 030734, W02007 / 093630, USP 6.071.517, W02008 / 024188, UA20070071675, USP 7,442,778, USP 7,235,641, USP 5,932,448 and USP 5,292,668. The term bispecific antibody is intended to include any agent, for example, a protein, a peptide or a protein or peptide complex, which has two different binding specificities and which binds to or interacts with (a) toxin A from C. difficile and (b) C. difficile toxin B. In one embodiment, the bispecific antibody comprises PA-39 or PA-50 or an antigen binding fragment thereof and PA-41 or an antigen binding fragment thereof. In one embodiment, the bispecific antibody comprises a chimeric or humanized form of PA-39 or PA-50 or an antigen-binding fragment thereof and PA-41 or an antigen-binding fragment thereof. Consequently, a bispecific antibody comprising PA-39 and PA-41 or chimeric or humanized forms of the same or an antigen binding fragment thereof, would bind to both toxin A and C. difficile toxin B. Similarly, a bispecific antibody comprising PA-50 and PA-41 or chimeric or humanized forms of the same or an antigen-binding fragment thereof, would bind to both toxin A and C. difficile toxin B. The term multispecific antibody is intended to include any agent, for example, a protein, a peptide or a protein or peptide complex, which has more than two different binding specificities and which binds to or interacts with (a) toxin A C. difficile, (b) C. difficile toxin B and (c) at least one other component. Accordingly, the invention includes, but is not limited to, bispecific, triespecific, tetra-specific and other multispecific antibodies. In one embodiment, antibodies or fragments that bind to bispecific antibody antigens or
79/183 multispecific are humanized.
The term bispecific antibodies further includes dianibody. The dianibody provides therapeutic antibodies that have dual specificity and that are able to target several different epitopes with a single molecule. Dianibodies are bivalent bispecific antibodies in which the VH and VL domains are expressed in an isolated polypeptide chain, but using a linker that is too short to allow pairing between the two domains in the same chain, thus forcing the domains to match domains complementary to another chain and creating two antigen-binding sites (see, for example, Holliger, P., and others. (1993) Proc. Natl. Acad. Sci. USA 90: 6444-6448; Poijak, RJ, and others (1994) Strueture 2: 1121-1123). The two antigen-binding regions of the bispecific antibody are chemically linked or expressed by a genetically engineered cell to produce the bispecific antibody. (See generally, Fanger et al., 1995 Drug News & Perspec. 8 (3): 133-137). In one embodiment, an efficient amount of a bispecific antibody can be administered to an individual with C. difficile infection and / or a C. difficile associated disease and the bispecific antibody neutralizes toxin A and toxin B toxicity in the individual.
In certain embodiments, the antibodies can be human antibodies. The term human antibody, as used herein, is intended to include antibodies that have variable Ig regions and are constant derived from human germline immunoglobulin sequences. Human antibodies can include amino acid residues not encoded by human germline immunoglobulin sequences (for example, mutations introduced through random or site-specific mutagenesis in vitro or via somatic mutation in vivo). However, the term human antibody, as used here, is not intended to include antibodies in which CDR sequences derived from the germline of another mammal species, such as a mouse, have been grafted onto human structural sequences (referred to here as antibodies humanized). Human antibodies directed against
80/183 toxin A and / or toxin B can be generated using genetically modified transgenic mice created to express components of the human immune system instead of the mouse system.
Complete monoclonal human antibodies can also be prepared by immunizing transgenic mice for large portions of human immunoglobulin heavy and light chain loci. See, for example, U.S. Patents 5,591,669, 5,598,369, 5,545,806, 5,545,807, 6,150,584 and references cited here, the contents of which are incorporated herein by reference. These animals have been genetically modified so that there is a functional deletion in the production of endogenous antibodies (for example, murines). The animals are further modified to contain all or part of the locus of the human germline immunoglobulin gene so that the immunization of these animals results in the production of complete human antibodies to the antigen of interest. After immunizing these mice (for example, XenoMouse (Abgenix), HumAb mice (Medarex / GenPharm)), monoclonal antibodies are prepared according to standardized hybridoma technology. These monoclonal antibodies have human immunoglobulin amino acid sequences and therefore will not elicit human mouse anti-antibody (HAMA) responses when administered to humans.
Those skilled in the art will appreciate that nucleic acids and polynucleotides encoding the described antibodies or fragments that bind to antigens thereof are also provided here. It will also be considered that nucleic acids and polynucleotides which comprise a sequence encoding antibodies or fragments that bind to antigens thereof are provided here. Vectors and plasmids engineered to contain and / or express nucleic acids and antibody-encoding polynucleotides are therefore provided by the invention. As used herein, a coding region refers to a region of a nucleotide sequence that encodes a polypeptide sequence; the coding region can include a region that encodes a
81/183 portion of a protein that is subsequently cleaved, such as a signal peptide. In some cases, nucleotide and amino acid sequences may include sequences that encode or that are signal peptides. The invention contains each of these sequences with or without, the portion of the sequence that encodes or is a signal peptide.
The antibodies provided here can be cloned using the method below, as well as other methods known to those of ordinary skill in the art. As a non-limiting example, total RNA is generated from hybridoma cells and the cDNA is transcribed in reverse using an oligo-dT primer. RNase H can be used to remove the RNA to make the stranded cDNA simple. Column purification with centrifugation can be used to remove free nucleotides. Then, a 3 'poly-dG tail can be added with terminal transferase. PCR amplification can be performed using an oligo-dC primer plus a degenerate primer for the constant region. Approximately 40 cycles can be performed for robust amplification of the heavy chain. Direct sequencing of PCR products can then be performed.
In certain embodiments, the antibody or antigen-binding fragment thereof is encoded by a nucleic acid molecule that is highly homologous to the previous nucleic acid molecules. The homologous nucleic acid molecule can comprise a nucleotide sequence that is at least approximately 90% identical to the nucleotide sequence provided here. The homologous nucleic acid molecule can comprise a nucleotide sequence that is at least approximately 95% identical, at least approximately 97% identical, at least approximately 98% identical or at least approximately 99% identical to the nucleotide sequence provided herein. Homology can be calculated using a number of publicly available software tools well known to one of ordinary skill in the art. Examples of tools include the BLAST system available on the website of the National Center for Biotechnology Information (NCBI) at the National Institutes of
82/183
Cheers.
One method of identifying highly homologous nucleotide sequences is by hybridizing nucleic acids. Also provided here are antibodies that have binding properties with toxin A and / or toxin B and other functional properties described here, which are encoded by nucleic acid molecules that hybridize under stringent conditions to the nucleic acid molecules that encode antibodies of the invention. Identification of related sequences can also be accomplished using polymerase chain reaction (PCR) and other amplification techniques suitable for cloning related nucleic acid sequences. For such techniques, PCR primers are typically selected for the amplification portions of a nucleic acid sequence of interest, such as a CDR.
The term high stringency conditions as used herein and _re f _er parameters to which the art is familiar. The nucleic acid hybridization parameters can be found in references that compile such methods, for example, Molecular Cloning: A Laboratory Manual, J. Sambrook, et al., Eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor , New York, 1989 or Current Protocols in Molecular Biology, FM Ausubel, et al., Eds., John Wiley & Sons, Inc., New York. A non-limiting example of high stringency conditions is hybridization at 65 ° C in hybridization buffer (3.5X SSC, 0.02% Ficoll, 0.02% polyvinyl pyrrolidone, 0.02% Bovine Serum Albumin , 2.5 mM NaH ₂ PO ₄ (pH7), 0.5% SDS, 2 mM EDTA). SSC is 0.15M sodium chloride / 0.015M sodium citrate, pH7; SDS is sodium dodecyl sulfate; and EDTA is ethylenediaminetetraacetic acid. After hybridization, a membrane to which the nucleic acid is transferred is washed, for example, in 2X SSC at room temperature and then at 0.1 - 0.5X SSC / 0.1X SDS at temperatures up to 68 ° C.
Vectors are provided here (for example, expression vectors) or plasmids comprising the described nucleic acid molecules, in addition to other nucleic acid sequences, for example, if
83/183 ORI, promoter, intensifier, termination sequences, necessary for the expression of proteins, polypeptides or peptides. The vectors can be used to transform or transfect host cells to produce antibodies or fragments that bind to antigens with the specificity of binding and / or characteristics of the antibodies or fragments that bind to antigens described herein. In one embodiment, the vectors may comprise an isolated nucleic acid molecule encoding the heavy chain or a portion thereof of the antibodies and fragments that bind to the provided antigens. In another embodiment, the vectors may comprise the nucleic acid sequences that encode the light chain or a part thereof. In a further embodiment, the vectors of the invention can comprise a sequence for a heavy chain or a portion of it and a sequence of a light chain or a portion thereof. In an additional embodiment, plasmids are provided that produce the antibodies or antigen-binding fragments described herein.
Modified versions of the antibodies of the invention are also provided. Modifications to an antibody or antigen-binding fragment thereof are typically produced in the nucleic acid encoding the antibody or antigen-binding fragment thereof and may include deletions, point mutations, truncations, amino acid substitutions and amino acid additions or groups other than amino acids. Alternatively, modifications can be made directly to the polypeptide, such as through divage, adding a linker molecule, adding a detectable group, such as biotin, adding a fatty acid and the like. The modifications may also contain fusion proteins that comprise all or part of the antibody or the antigen-binding fragment of the antigen. The modifications further include the coupling or binding of the antibody with another agent, such as a cytotoxic agent, a drug or a therapeutic agent.
Modified polypeptides include polypeptides that are specifically modified to alter a characteristic of the polypeptide
84/183 not related to its physiological activity. For example, cysteine residues can be replaced or deleted to prevent unwanted disulfide bonds. Similarly, certain amino acids can be altered to increase the expression of a polypeptide by eliminating proteolysis by proteases in an expression system (for example, dibasic amino acid residues in yeast expression systems where KEX2 protease activity is present) . In addition, one or more amino acids can be altered, particularly in the Ig constant region, to prevent proteolytic degradation of the antibody by enzymes after certain administration routes, for example, oral administration, as described, for example, in W02006 / 071877, published on July 6, 2006.
The modifications are conveniently prepared by altering a nucleic acid molecule that encodes the polypeptide. Mutations of a nucleic acid encoding a polypeptide preferably preserve the amino acid reading frame of the coding sequence and preferably do not create regions in the nucleic acid that are likely to hybridize to form secondary structures, such as hairpins or loops, which can be harmful expression of the modified polypeptide.
Modifications can be made to any of the antibodies or fragments that bind to antigens on them by selecting an amino acid substitution or by random mutagenesis of a selected site in a nucleic acid encoding the polypeptide. The modified polypeptides can then be expressed and tested for one or more activities to determine which mutation provides a modified polypeptide with desired properties. Additional mutations can be produced in modified polypeptides (or unmodified polypeptides) that are silent as an amino acid sequence of the polypeptide, but which provide preferred codons for translation in a particular host. Preferred codons for translating a nucleic acid, for example, into E. coli, are well known to those of ordinary skill in the art. Still other mutations can be made in the sequences
85/183 not encoding a sequence or cDNA clone to increase polypeptide expression. The activity of modified polypeptides can be tested by cloning the gene encoding the modified polypeptide into an expression vector, introducing the vector into an appropriate host cell, expressing the modified polypeptide and testing for functional capacity of polypeptides that are disclosed here. The foregoing procedures are well known to one of ordinary skill in the art.
The person skilled in the art will also realize that conservative amino acid substitutions can be made in the polypeptides to provide functionally equivalent polypeptides. As used herein, a conservative amino acid substitution refers to an amino acid substitution that does not alter the relative charge or size characteristics of the protein on which the amino acid substitution is made. Modified polypeptides can be prepared according to methods for altering a polypeptide sequence that are known to a person skilled in the art, such as can be found in references that compile such methods, for example, Molecular Cloning: A Laboratory Manual , J. Sambrook, et al., Eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989 or Current Protocols in Molecular Biology, FM Ausubel, et al., Eds., John Wiley & Sons , Inc., New York. Conservative amino acid substitutions include substitutions made between amino acids within the following group examples: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H; (d) A, G; (e) S, T; (f) Q, N; and (g) E, D.
Conservative amino acid substitutions in polypeptides are typically accomplished by changing a nucleic acid that encodes a polypeptide. Such substitutions can be made using a variety of methods known to one of ordinary skill in the art. For example, amino acid substitutions can be done through PCR-directed mutation, site-directed mutagenesis or through chemical synthesis of a gene that encodes a polypeptide. When amino acid substitutions are made in a small fragment of a
86/183 polypeptide, substitutions can be made through direct peptide synthesis. The activity of functionally equivalent polypeptide fragments can be tested by cloning the gene encoding the altered polypeptide within a bacterial or mammalian expression vector, introducing it into an appropriate host cell, altering the expression of the altered polypeptide and testing it on regarding a functional capacity of the polypeptides that are disclosed here.
An antitoxin antibody or antigen-binding portion of the invention can be derivatized or linked to another functional molecule, for example, another peptide or protein. In addition, an antibody or antibody portion may be functionally linked, for example, through chemical coupling, genetic fusion, non-covalent association, etc., to one or more other molecular entities, such as another antibody, a detectable agent, a cytotoxic agent, a therapeutic agent, a pharmaceutical agent and / or a protein or a peptide that can mediate association with another molecule, for example, a streptavidin central region or a polyhistidine tag.
A derivatized protein or antibody can be produced by cross-linking or by coupling two or more proteins or antibodies of the same or different types. Suitable crosslinking agents or binding agents include those that are heterobifunctional, that have two distinct reaction groups separated by an appropriate spacer (for example, m-maleimidobenzoyl-N-hydroxysuccinimide ester) or homobifunctional (for example, suberate dissuccinimidyl) and commercially available (Pierce Chemical Company, Rockford, IL). An antitoxin antibody or antigen-binding fragment thereof can be conjugated to another molecular entity, such as a label. Detectable agents or labels with which a protein can be derivatized or labeled include fluorescent compounds, enzymes, prosthetic groups (for example, streptavidin / biotin and avidin / biotin), chemiluminescent materials, bioluminescent materials, chemical entities and radioactive materials
87/183 assets. Examples of detectable fluorescent compounds include fluoresceins, fluorescein isothiocyanate (FITC), rhodamine and phycoerythrin. A protein or antibody can also be derivatized with detectable enzymes, such as alkaline phosphatase (AP), horseradish peroxidase, beta-galactosidase, acetylcholinesterase, glucose oxidase, etc. Such enzymatically derived proteins or antibodies become detectable after the addition of a specific enzyme substrate in order to produce a detectable reaction product. Proteins derivatized with a prosthetic group, such as biotin, can be detected by indirect measurement of binding with avidin or streptavidin.
The labeled proteins and antibodies can be used as agents or reagents for diagnostics and / or experiments to isolate a known or predetermined antigen using standard techniques, such as affinity chromatography or immunoprecipitation or to detect a known or predetermined antigen in order to determine protein levels in the tissue as part of a clinical testing procedure, for example, to monitor the effectiveness of a certain treatment regimen. In one embodiment, the antigen that will be detected may be a toxin in a cell lysate or in a patient sample.
In a particular embodiment, the antibodies or fragments that bind to antigens of the invention are used in combination, for example, as a pharmaceutical composition comprising two or more different antibodies or fragments that bind to antigens thereof (for example, a or more directed against toxin A and one or more directed against toxin B, two or more directed against toxin A or two or more directed against toxin B etc.). The combinations of antibodies or fragments that bind to antigens on them can be combined into a single therapy (that is, administered simultaneously) to achieve a desired therapeutic effect. Alternatively, antibodies or fragments that bind to antigens can be administered separately (that is, at different times). Consequently, therefore, antibodies or fragments that bind to anti
88/183 genos of the same can be stored together or separately. Antibodies or fragments that bind to antigens can be stored in an aqueous medium or in a lyophilized form, which can be reconstituted before use.
In another embodiment, compositions comprising one or more isolated antibodies or an antigen-binding fragment thereof are provided. Compositions are also provided which comprise a combination of one or more of the aforementioned antibodies or fragments that bind to antigens thereof. Compositions are also provided, each containing one or more of the aforementioned antibodies or fragments that bind to antigens thereof, the compositions of which are intended for use in combination. Such compositions can include a physiologically or pharmaceutically acceptable carrier, excipient, carrier or diluent. The carrier, excipient, vehicle or physiologically or pharmaceutically acceptable diluent may be mixed with the isolated antibody or antigen-binding fragment thereof. In one embodiment, the compositions include a combination of several (e.g., two or more) antibodies or isolated fragments that bind to antigens thereof. In one embodiment, one or more of the antibodies or fragments that bind to antigens in the composition specifically bind to C. difficile toxin A and neutralize their toxic effects, while one or more of the antibodies or fragments that bind their antigens bind specifically to C. difficile toxin B and neutralize their toxic effects. In one embodiment, either one or more of the antibodies or fragments that bind to antigens thereof that specifically bind to C. difficile toxin A and neutralize their toxic effects, and one or more that bind specifically to C. B toxin. difficile and neutralize its toxic effects are humanized.
In a particular embodiment, the composition comprises a combination of an antitoxin A antibody or an antigen-binding fragment thereof as described herein and an antitoxin B antibody or
89/183 antigen-binding fragment thereof as described here. In such a composition, the anti-toxin A antibody and the anti-toxin B antibody can be present in equivalent amounts or proportions, for example, 1: 1. Alternatively, in such a composition, the anti-toxin A antibody and the anti-toxin B antibody may be present in different amounts or proportions, such as 1/2: 1; 2: 1; 3: 1; 4: 1 etc. In one embodiment, the antibodies in the composition are humanized. In one embodiment, the composition comprises a combination of mAb PTA-9888, an antigen-binding fragment of it or a humanized form of it and mAb 9693, an antigen-binding fragment of it or a humanized form of it. In one embodiment, the composition comprises a combination of mAb PTA-9694, an antigen-binding fragment of it or a humanized form of it and mAb 9693, an antigen-binding fragment of it or a humanized form of it. In one embodiment, the composition comprises a combination of any of the following: Mab PTA-9692, an antigen-binding fragment of it or a humanized form of it and mAb 9693, an antigen-binding fragment of it or a humanized form the same; or mAb PTA-9888, an antigen-binding fragment thereof or a humanized form thereof and mAb 9692, an antigen-binding fragment thereof or a humanized form thereof; or mAb PTA-9694, a fragment of antigen binding thereof or a humanized form of the same and mAb 9692, a fragment of antigen binding thereof or a humanized form of the same.
The pharmaceutical compositions can also be administered in combination therapy, that is, in combination with other therapeutic agents. For example, the combination therapy may include a composition that comprises one or more antibodies or fragments that bind antigens to them as provided herein with at least one other conventional therapy. Such additional therapeutic agents include antibiotic therapeutic agents and non-antibiotic therapeutic agents. Additional therapeutic agents include C. difficile toxoid vaccine,
90/183 ampicillin / amoxicillin, vancomycin, metronidazole, fidaxomycin, linezolid, nitazoxanide, rifaximin, ramosplanin, diphimycin (also called PAR-101 or OPT-80), clindamycin, cephalosporins (such as second and third generation cephalosporins), fluoroquinol (such as gatifloxacin or moxifloxacin), macrolides (for example, erythromycin, clarithromycin, azithromycin), penicillins, aminoglycosides, trimethoprim-sulfamethoxazole, chloramphenicol, tetracycline, imipenem and meropenem. Additional therapeutic agents further include antibiotics, antibacterial, bacteriocidal or bacteriostatic agents. In one embodiment, the additional therapeutic agent may be a small molecule or a low molecular weight chemical compound, which targets C. difficile and / or its toxins. In one embodiment, the additional therapeutic agent is OPT-80. Therapeutic agents that are not antibiotics include tolevamer, a high molecular weight anionic polymer that binds toxins A and B through non-specific loading mechanisms.
As an alternative, it is envisaged that antibodies or fragments that bind to antigens of the same invention can be used in combination with other antibodies or fragments that bind to antigens thereof. Other additional therapeutic agents include i20 normal pooled munoglobulin, intravenous immunoglobulin or anti-toxin A and anti-toxin B immunoglobulins in serum. Other antibodies include human mAbs directed against toxin A or C. difficile toxin B, as described and reported in the published literature (for example, WO / 2006/121422; US2005 / 0287150).
Also covered here is a method involving the use of antibodies or fragments that bind to antigens of the invention for treatment or prophylaxis, that is, to treat, resolve, improve, eradicate, prevent or delay the infection caused by C. difficile or disease associated with C. difficile, pathology or development or progression thereof. CDAD is typically precipitated by the disturbance of colonic flora through the use of antibiotics such as clindamycin, cephalosporins and fluoroquinolones. This disturbance in the colonic microenvironment,
91/183 together with exposure to C. difficile spores, leads to colonization in afflicted individuals. Approximately one third of all patients who become colonized develop CDAD, which can result in severe diarrhea, colon perforation, colectomy and death. Therefore, methods 5 are provided in which an individual receives administration of one or more antibodies of the invention or a composition that is described herein to treat infection caused by C. difficile or CDAD.
As used here, treating refers to any benefit to an individual with C. difficile infection or a disease associated with C.
difficile conferred by administering the antibodies or a composition or combination of compositions provided here. For example, and without limitation, such a benefit may be the elimination of one or more symptoms or adverse effects or the reduction in or improvement in the severity of one or more symptoms or adverse effects that result from infection or disease; a - 15 delay, interruption or reversal in the progression of the infection or disease; a recolonization, a resurgence or a repopulation of the normal and natural microflora of the gastrointestinal tract, colon, intestine, etc. or the cure of the infection or disease (that is, a doctor would assess the individual and determine that the individual no longer has the infection or disease). Symptoms or adverse effects associated with C. difficile infection include dehydration, diarrhea, cramps, kidney failure, intestinal perforation, toxic megacolon, which can lead to colon rupture and death. The compositions provided can be used to reduce, decrease, ameliorate or eliminate any or all of the symptoms or adverse effects provided here.
As used here, an infection caused by C. difficile refers to an infection that results from the presence of C. difficile in the intestinal flora where it was not previously present or an alteration in the presence of C. difficile in the intestinal flora (for example, an increase in the total amount of C. difficile in relation to one or more other bacteria, etc.), which gives rise or may give rise to adverse effect (s) and / or an increase in the level of A and / or toxins B in the intestine or other organs and tissues comprising
92/183 dem the gastrointestinal tract. Typically, CDAD results from the acquisition and proliferation of C. difficile in the intestines. In vivo, toxins A and B demonstrate different pathological profiles with potential synergy in the cause of the disease. In rabbits and mice, for example, toxin A is an enterotoxin that induces diarrhea, while toxin B does not activate a fluid response in these species. However, toxin B is more potent cytotoxic in vitro. C. difficile toxin A negative strains positive for C. difficile toxin B (A-B +) have been increasingly reported. Strains A- / B + fail to produce toxin A due to the deletion of the repetitive domain of the tcdA gene and still 10 are capable of causing clinical disease. In contrast, there are no reports so far of positive strains for toxin A and negative for toxin B (A + / B-) in humans.
C. difficile infection commonly manifests itself as mild to moderate diarrhea, occasionally with abdominal cramps. Pseu- 15 domembranes, which are yellowish white plaques adhering to the intestinal mucosa, are occasionally observed. In rare cases, patients with C. difficile infection may experience acute, life-threatening abdominal colitis that results from a disturbance of normal colon bacterial flora, colonization with C. difficile 20 and the release of toxins that cause inflammation and mucus damage. Antibiotic therapy is the key factor that changes the colonic flora. Although the intestinal flora resists colonization and overgrowth with C. difficile, the use of antibiotics, which suppress normal flora, allows the C. difficile bacteria to proliferate. C. difficile is present in 2-3% of healthy adults 25 and as much as 70% of healthy babies. In one aspect, the mAbs of the present invention are used to treat individuals who are asymptomatic, but who are susceptible to or at risk of contracting infection caused by C. difficile and becoming affected with their associated diseases. Such individuals may be hospitalized or may be outside a hospital facility.
The main risk factor for C. difficile-related disease is previous exposure to antibiotics. The most common antibiotics implied
93/183 cites in C. difficile colitis include cephalosporins (especially second and third generations), ampicillin / amoxicillin and clindamycin. The least commonly implicated antibiotics are macrolides (ie, erythromycin, clarithromycin, azithromycin) and other penicillins. The compounds or other agents that are occasionally reported to cause the disease include aminoglycosides, fluoroquinolones, trimethoprim-sulfamethoxazole, metronidazole, chloramphenicol, tetracycline, imipenem and meropenem. Even a brief exposure to a single antibiotic can cause C difficile colitis, particularly if the normal intestinal flora is adversely affected or killed. A prolonged course of antibiotics or the use of two or more antibiotics increases the risk of illness. Antibiotics traditionally used to treat colitis caused by C. difficile have been shown to cause disease. Other risk factors associated with C. difficile infection include advanced age (> 65 years); weakened immune system; recent hospitalization (particularly sharing a hospital room with an infected patient, staying in intensive care units and prolonged hospital stays); living in a nursing home, hospice or other long-term care unit; abdominal surgery; chronic colonic disease, (for example, inflammatory bowel disease (IBD) or colorectal cancer); taking prescription or over-the-counter antacids that can reduce stomach acid and allow C. difficile to pass more easily into the intestine; and a previous infection caused by C. difficile. More factors associated with C. difficile disease include antineoplastic agents, mainly methotrexate, hemolytic-uremic syndrome, malignancies, intestinal ischemia, kidney failure, necrotizing enterocolitis, Hirschsprung's disease, IBD and non-surgical gastrointestinal procedures, including nasogastric tubes. Individuals who can receive administration of the compositions provided here include any of the individuals described who are at risk of infection from C. difficile.
Although most patients with C. difficile colitis recover without specific therapy, symptoms can be prolonged
94/183 and debilitating. Diarrhea associated with C. difficile can be a serious health condition with a mortality rate of up to 25% in elderly patients who are fragile. Reports that focus on more seriously ill patients indicate mortality rates of 10-30%. Infection caused by C. difficile is more common in the elderly, and old age can promote susceptibility to colonization and disease. Although infants and young children often carry C. difficile and its toxins, clinical infection is uncommon. Cross-infection with C. difficile is common in neonatal units, but newborns do not appear to develop diarrhea associated with C. difficile.
A number of methods are provided here that use the humanized antibodies of the invention and / or the compositions provided here. For example, a method for treating an individual who has an infection or illness caused by C. difficile, exhibits any of the symptoms or adverse effects provided here, or has any of the diseases provided here is provided. In one embodiment, the method reduces, decreases or improves the severity of disease associated with C. difficile infection or disease associated with C. difficile in an individual. As another example, a method of treating an individual who is afflicted with diarrhea associated with C. difficile is provided.
A method of neutralizing toxin A and / or C. difficile toxin B in an individual is also provided. As an example, a method of neutralizing combined systemic toxin A and toxin B from C. difficile is provided. In one embodiment, the combined systemic toxin A and toxin B of C. difficile are neutralized by the administration of either a humanized anti-toxin A antibody or an antigen-binding fragment thereof or a humanized anti-toxin B antibody or antigen-binding fragment of the same or a composition comprising these antibodies. In another aspect, the combined systemic toxin A and toxin B of C. difficile are neutralized by the administration of an antibody or an antigen-binding fragment thereof that specifically binds both toxin A and toxin B or a composition that
95/183 comprises the antibody (for example, in humanized form). In some embodiments, humanized antibodies or compositions are administered in combination with another therapeutic agent that targets C. difficile.
As another modality, a method of restoring normal gastrointestinal flora in an individual infected with C. difficile, thereby effectively treating infection caused by C. difficile and / or its toxins, is also provided. As yet another modality, a method of reducing an individual's susceptibility to C. difficile infection or C. difficile-associated disease is also provided. As another modality, a method of preventing infection by C. difficile or disease associated with C. difficile in an individual is provided.
In the aforementioned methods, the individual receives administration of one or more of the antibodies or compositions provided here (for example, a composition comprising a monoclonal antibody or an antigen-binding fragment thereof directed against C. difficile toxin A and a composition comprising a monoclonal antibody or antigen-binding fragment directed against C. difficile toxin B). The compositions can be administered to the individual at the same time or at different times. The compositions can be administered to the individual as a mixture in a composition comprising a pharmaceutically acceptable carrier, vehicle or excipient and optionally another antibiotic, non-antibiotic, drug or therapeutic agent effective against C. difficile and / or its enterotoxins.
A humanized anti-toxin A monoclonal antibody or antigen-binding fragment thereof and / or a humanized anti-toxin B monoclonal antibody or antigen-binding fragment thereof or a pharmaceutically acceptable composition comprising humanized antibodies or fragments that bind antigens of them, separately or together, can be used in any of the methods described according to the invention.
As used herein, pharmaceutically acceptable carrier or
96/183 physiologically acceptable carrier includes any and all salts, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption retarding agents and the like that are physiologically compatible. Preferably, the carrier is suitable for oral, intravenous, intraperitoneal, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (for example, by injection or infusion). Depending on the route of administration, the active compound, that is, the antibody can be coated in a material to protect the compound from the action of acids and other natural conditions that can inactivate the compound.
When administered, the pharmaceutical preparations of the invention are applied in pharmaceutically acceptable amounts and in pharmaceutically acceptable compositions. The term pharmaceutically acceptable means a non-toxic physiologically acceptable material that does not interfere with the effectiveness of the biological activity of the active ingredients. Such preparations may routinely contain salts, buffering agents, preservatives, compatible carriers and optionally other therapeutic agents, such as supplementary immune enhancing agents, including adjuvants, chemokines and cytokines. When used in medicine, salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts can be conveniently used to prepare pharmaceutically acceptable salts therefrom and are not excluded from the scope of the invention.
A salt maintains the desired biological activity of the parent compound and does not confer any undesired toxicological effects (see, for example, Berge, S.M. et al. (1977) J. Pharm. Sci. 66: 1-19). Examples of such salts include acid addition salts and basic addition salts. Acid addition salts include those derived from non-toxic inorganic acids, such as hydrochloric, nitric, phosphoric, sulfuric, hydrobromic, hydroiodic, phosphorous and the like, as well as non-toxic organic acids such as aliphatic mono and dicarboxylic acids, substituted alkanoic acids phenyl, alkanoic hydroxy acids, aromatic acids, aliphatic sulfonic acids and
Aromatic 97/183 and the like. Basic addition salts include those derived from alkaline earth metals, such as sodium, potassium, magnesium, calcium and the like, as well as from non-toxic organic amides, such as Ν, Ν'-dibenzylethylenediamine, N-methylglucamine, chloroprocaine, choline, diet5 nolamine, ethylenediamine, ethylenediamine acetate (EDTA), with or without an indicator ion, such as sodium or calcium, procaine and the like.
Any of the compositions of the invention can be combined, if desired, with a pharmaceutically acceptable carrier. The term pharmaceutically acceptable carrier as used herein means one or 10 more compatible solid or liquid fillings, diluents or encapsulating substances that are suitable for administration to a human. The term carrier means an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate application. The components of the pharmaceutical compositions are also capable of being mixed with the molecules of the supplied compositions and with each other, in such a way that there is no interaction that would substantially impair the desired pharmaceutical efficacy.
Pharmaceutical compositions may contain suitable buffering agents, including: acetic acid in a salt; citric acid in a salt; boric acid in a salt; and phosphoric acid in a salt.
Pharmaceutical compositions may also optionally contain suitable preservatives, such as: benzalkonium chloride; chlorobutanol; and parabens.
The pharmaceutical compositions can be conveniently presented in unit dosage strength and can be prepared by any of the methods well known in the art of pharmacy. All methods include the step of placing the active agent in association with a carrier that constitutes one or more accessory ingredients. In general, compositions are prepared by uniformly and intimately placing the active compound in association with a liquid carrier, a finely divided solid carrier or both and then, if necessary, shaping the product.
98/183
The anti-toxin A and anti-toxin B antibodies of the invention, or portions thereof, can be provided according to dosage regimens that can be adjusted to provide the desired optimal response, such as a therapeutic or prophylactic response, in an individual. Illustratively, a single bolus may be administered, several divided doses may be administered over time, or the dose may be reduced or increased proportionally, as may be indicated by a particular therapeutic situation. Parenteral compositions can be packaged or prepared in unit dosage form to facilitate administration and uniformity of dosage. The unit dosage form refers to physically distinct units provided in the form of unit dosages for the individuals to be treated, where each unit contains a predetermined amount of the active compound calculated to produce the desired therapeutic effect in association with the carrier, the required vehicle, excipient or pharmaceutical diluent. The specification for unit dosage forms of the invention is determined by and is directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic effect that will be achieved and (b) the limitations inherent in the art of obtaining compounds such as a compound active for the treatment of sensitivity in individuals.
Compositions suitable for parenteral administration conveniently comprise a sterile aqueous or non-aqueous preparation, which is preferably isotonic with respect to the recipient's blood. This preparation can be formulated according to known methods using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation can also be a sterile solution or suspension for injection in a diluent or a non-toxic parenterally acceptable solvent, for example, in the form of a solution in 1,3-butane diol. Among the vehicles and suitable solvents that can be used are water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this finali
99/183 any soft fixed oil can be used including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can be used in the preparation of injectable products. Carrier formulations suitable for oral, subcutaneous, intraperitoneal, intravenous, intramuscular administration etc. can be found at Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA.
The active components can be prepared with carriers that will protect the components against rapid release, such as a controlled release formulation, including microencapsulated implants and delivery systems. Biodegradable biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyesters and polylactic acid. Many methods for preparing such formulations are patented or generally known to those skilled in the art. See, for example, Sustained and Controlled Release Drug Delivery Systems, J.R. Robinson, ed., Marcel Dekker, Inc., New York, 1978.
The antibody and compositions of the invention as therapeutic agents can be administered via any conventional route, including injection or by gradual infusion over time. The route of administration can, as non-limiting examples, be oral, intravenous, subcutaneous, intraperitoneal, intramuscular, intrathecal, intracavity, retroorbital, vaginal, rectal, by inhalation, aspiration, dermal, suppository or transdermal.
Antibodies and compositions of the invention are administered in efficient amounts or doses. An efficient amount is such an amount of an antibody or antigen-binding fragment thereof or composition (s) that is (are) provided here that alone or together with additional doses or other therapeutic agent (s) (s), produces (m) the desired response, for example, treats (m), improves (m), eradicates (m), resolves (m) or prevents (m) infection caused by C. difficile, diarrhea or a disease associated with C. difficile in an individual. This may only involve slowing the progression of infection, diarrhea or illness over a period of time.
100/183 extended period, for example, longer than one week, two weeks, three weeks, one month, two months, three months or more than three months. However, such effective amounts optimally treat or halt the progression of infection, diarrhea or disease permanently. This can be monitored using routine methods. The desired response to the treatment of the disease or the state of health can also be delayed onset or even the prevention of the onset of infection or disease.
The effective amounts will, of course, depend on the particular infection or disease to be treated, the severity of the infection or disease, the individual parameters of the patient including age, physical condition, size and weight, the duration of treatment, the nature of the concurrent therapy (if any), the specific administration route and similar factors within the health agent's knowledge and expertise. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine testing and experiments. It is generally preferred that a maximum dose of the individual components or combinations thereof is used, that is, the highest safe dose according to reasonable medical judgment. It will be understood by ordinary experts in the art, however, that a patient may insist on a lower dose or a tolerable dose for medical reasons, psychological reasons or for virtually any other reason.
The pharmaceutical compositions used in the foregoing methods are preferably sterile and contain an efficient amount of one or more antibodies or fragments that bind to antigens provided here for producing the desired response in a unit of weight or volume suitable for administration to a patient. The response can, for example, be measured by determining the physiological effects of the composition, such as decreasing the symptoms of the disease. Other tests will be known to a person skilled in the art and can be used to measure the level of the response.
The doses or quantities of the compositions administered to
101/183 an individual can be chosen according to different parameters, in particular according to the mode of administration used and the condition of the individual. Other factors include the desired treatment period. In the event that a response in an individual is insufficient at the initial doses applied, higher doses (or efficiently higher doses through a more localized delivery route) can be employed to the extent that the patient's tolerance allows.
In general, doses or amounts can vary from approximately 1 pg / kg to approximately 100,000 pg / kg. Non-limiting examples of dose ranges that constitute a therapeutically or prophylactically efficient amount of an antibody, antibody portion or composition of the invention include 0.1 mg / kg-100 mg / kg; 0.1 mg / kg-60 mg / kg; from 0.5 mg / kg-75 mg / kg; 0.5 mg / kg-25 mg / kg; 0.75 mg / kg-40 mg / kg; 1 mg / kg-50 mg / kg; or 1 mg / kg-5 mg / kg. It will be considered that for any particular individual, patient or individual, specific doses and dosage regimens should be adjusted over time according to the individual's need and the professional judgment of the expert who is the administration or supervision of the administration of antibodies and / or compositions. Such dose ranges are only examples and are not intended to limit the scope or practice of the invention. Based on the composition, the dose can be delivered continuously, such as through a continuous pump or periodic intervals. The desired time intervals for various doses of a particular composition can be determined without unnecessary experiments by one skilled in the art. Other protocols for administering the compositions will be known to one of ordinary skill in the art, in which the dose amount, the schedule of administration, the sites of administration, the mode of administration and the like vary from what has been described above.
The administration of the compositions to mammals other than humans, for example, for testing purposes or for veterinary therapeutic purposes, is carried out under substantially the same conditions as described above.
102/183
Kits comprising antibodies of the invention or compositions comprising antibodies of the invention and instructions for use are also provided here. The kits may further contain at least one additional reagent, such as an additional therapeutic agent or one or more additional antibodies or fragments that bind to antigens that are provided here (for example, an antibody or antigen binding fragment thereof to the toxin A when the first antibody or antigen-binding fragment of the kit is an antibody or an antigen-binding fragment of the same to toxin B and vice versa).
The kit components can be packaged in an aqueous medium or in lyophilized form. When antibodies or fragments that bind to antigens are used in kits in the form of conjugates (for example, a bispecific antibody conjugate), the components of such conjugates can be supplied in completely conjugated form, in the form of intermediates or in the form of separate groups that will be combined by the user or the kit according to the instructions for use provided.
A kit may comprise a carrier that is compartmentalized to receive in intimate confinement there one or more container means or a series of container means, such as test tubes, vials, flasks, bottles, syringes or the like. A first container means or a series of container means may contain one or more antibodies or fragments that bind to antigens thereon. A second container means or series of container means may contain one or more antibodies or fragments that bind to antigens on them, wherein the antibodies or fragments that bind to antigens on them are different from those on the first container means or some other additional therapeutic agent. The kits provided here can also include a third container that contains a molecule for binding antibodies or fragments that bind to antigens contained in the first and second containers.
As used here in relation to polypeptides, proteins
103/183 or fragments thereof, isolated means separated from its native environment and present in sufficient quantity to permit its identification or use. Isolated, when referring to a protein or polypeptide, it means, for example: (i) selectively produced by expression cloning or (ii) purified by chromatography or electrophoresis. Isolated proteins or polypeptides can be, but need not be, substantially pure. The term substantially pure means that proteins or polypeptides are essentially free of other substances with which they can be found in nature or in in vivo systems to a practical and appropriate extent for their intended use. Substantially pure polypeptides can be produced by techniques well known in the art. Due to the fact that an isolated protein can be mixed with a pharmaceutically acceptable carrier in a pharmaceutical preparation, the protein can comprise only a small percentage by weight of the preparation. The protein is, however, isolated because it has been separated from the substances with which it can be naturally associated in living systems, that is, isolated from other naturally occurring proteins.
Methods for evaluating a candidate agent for efficacy in the treatment of infection caused by C. difficile or disease associated with C. difficile are also provided. Such methods may comprise the steps of treating an individual with an agent that increases the risk of infection caused by C. difficile or disease associated with C. difficile in the individual, inoculating the individual with C. difficile, treating the individual with the candidate agent and evaluating the effectiveness of treatment with the candidate agent. As used here, an agent that increases the risk of infection caused by C. difficile or disease associated with C. difficile is any agent that is believed to promote the onset or progression of infection caused by C. difficile or disease associated with C. difficile. Such an agent can be an antibiotic or non-antibiotic agent. For example, the agent can be any of the antibiotics described here. Illustratively, such an antibiotic may be metronized clindamycin, vancomycin, fidaxomycin, nitazoxani104 / 183 da, rifaximin branchplanin or a combination thereof.
In these methods, the candidate agent can be administered to the individual before or after inoculation with C. difficile. The candidate agent can be any agent believed to have the potential for treatment or prevention of infection caused by C. difficile or disease associated with C. difficile. Candidate agents, which can be an antibiotic or a non-antibiotic, include antibodies or fragments that bind to antigens thereof that specifically bind toxin A and / or toxin B of C. difficile.
These methods include any of the in vitro and in vivo methods described in the Examples here below.
The ultimate goal of CDAD treatment is to discontinue all antibiotics and allow the restoration of normal intestinal microflora. According to the invention, the antitoxin mAbs A and B described here can provide non-antibiotic therapies designed to block the pathogenic effects of the C. difficiles toxin, allow the discontinuation of antibiotics and thereby provide time for the colon to heal and microflora normal intestinal system is restored. The monoclonal antibodies of the invention demonstrated complete and durable protection (> 37 days) in a rigorous CDAD hamster model. Based on their exceptional characteristics and properties, the C. difficile antitoxin A and toxin B mAbs of the invention provide new treatment options and medications for patients who have weakly availed of existing therapies, including those individuals afflicted with the most severe cases of illness .
The present invention further encompasses a vaccine or an immunogenic agent comprising portions, fragments or peptides of toxin A and / or toxin B of C. difficile containing the epitopic regions recognized and / or linked by one or more monoclonal antibody PA-39 (ATCC Accession No. PTA-9692), a humanized form of PA-39, the monoclonal antibody PA-50 (ATCC Accession No. PTA-9694), a humanized form of PA-50, the monoclonal antibody PA -41 (ATCC Accession No. PTA-9693), a humanized form of PA-41, an antibody that competes
105/183 by the binding of toxin A with monoclonal antibody PA-39 or a humanized form of it, an antibody that competes for the binding of toxin A with monoclonal antibody PA-50 or a humanized form of it or an antibody that competes for binding of toxin B with PA-41 monoclonal antibody or a humanized form thereof. In one embodiment, the vaccine or immunogenic agent comprises portions, fragments or peptides of toxin A and C. difficile toxin B containing the epitopic regions recognized and / or linked by one or more of monoclonal antibody PA-39 (Accession No. ATCC PTA-9692), a humanized form of PA-39 or an antibody that competes to bind toxin A and toxin B to monoclonal antibody PA-39 or a humanized form thereof. In one embodiment, the portions, fragments or peptides that contain toxin A and / or toxin B epitopes of the vaccine or immunogenic agent are derived from the toxin A or toxin B protein through proteolytic divination. In one embodiment, the fragments, portions or peptides of toxin A from the vaccine or immunogenic agent are produced by proteolytic divination by enterokinase. In one embodiment, fragments, portions or peptides of the toxin B of the vaccine or immunogenic agent are produced by proteolytic divination by caspase (caspase 1). In one embodiment, the portions or fragments containing the vaccine or immunogenic agent epitope are peptides that are chemically or recombinantly synthesized from the toxin A or toxin B protein. In one embodiment, the fragments, portions or peptides from the vaccine or immunogenic agent containing one or more epitopic regions of toxin A and / or toxin B that are recognized and linked by the antibody are derived from one or more of the amino terminals of toxin A; the amino terminals of toxin B; the carboxy terminals of toxin A; the carboxy terminals of toxin B; the toxin A receptor binding domain; a region outside the toxin A receptor binding domain; the N-terminal enzymatic region of toxin B; the toxin A glycosyltransferase domain; the toxin B glycosyltransferase domain; the proteolytic domain of toxin A; the proteolytic domain of toxin B; the hydrophobic pore-forming domain of toxin A; or the training domain
106/183 of hydrophobic pores of toxin B.
In some embodiments, fragments containing one or more epitopic regions recognized and linked by antibodies are derived from the amino terminals of toxin A or toxin B. In some embodiments, fragments containing one or more epitopic regions recognized and linked by antibodies are derived from carboxy terminals of toxin A or toxin B. In some embodiments, fragments containing one or more epitopic regions recognized and linked by antibodies are derived from the toxin A or toxin B glycosyltransferase domain. In some embodiments, fragments containing one or more more epitopic regions recognized and linked by antibodies are derived from the proteolytic domain of toxin A or toxin B. In some embodiments, fragments containing one or more epitopic regions recognized and linked by antibodies are derived from the hydrophobic pore-forming domain of toxin A or of toxin B. In some embodiments, the fragments s containing one or more epitopic regions recognized and linked by the antibodies are derived from the toxin A receptor binding domain. In some embodiments, fragments containing one or more epitopic regions recognized and linked by the antibodies are derived from the receptor binding domain of the toxin. toxin B. In some embodiments, fragments containing one or more epitopic regions recognized and linked by antibodies are derived from a region outside the toxin A receptor binding domain. In some embodiments, fragments containing one or more recognized epitopic regions and bound by the antibodies are derived from the N-terminal enzyme region of toxin B. In one embodiment, fragments or portions containing toxin A and / or toxin B epitopes are <300 kDa in size. In other embodiments, fragments or portions containing toxin A and / or toxin B epitopes are -158-160 kDa, -100-105 kDa, for example, 103 kDa, -90-95 kDa, for example, 91 kDa and / or -63-68 kDa, for example, 63 kDa or 68 kDa in size. In other embodiments, fragments or portions that contain toxin A epitope are -158-160 kDa; -90-95 kDa, for example, 91 kDa and / or -63-68 kDa, for example, 68
107/183 kDa in size. In other embodiments, the fragments or portions containing toxin B epitope are -100-105 kDa, for example, 103 kDa and / or -63-68 kDa, for example, 63 kDa in size.
Such portions, fragments or peptides of the toxins, when administered in the form of a vaccine or an immunogenic agent to an individual infected with C. difficile or afflicted with disease associated with C. difficile, can activate a humoral response in the individual, that is, antibodies that have specificities for toxin A and / or toxin B, thus allowing the individual to mount an immune response against the toxins and to neutralize, block, reduce, improve, cure or treat the disease associated with C. difficile, infection or CDAD in the individual . Consequently, another modality provides a method of neutralizing, blocking, reducing, improving, treating or treating infection caused by C. difficile or a disease associated with C. difficile in an individual who needs it, which includes administering to the individual a efficient amount of the vaccine or immunogenic agent described above. In one embodiment, the individual activates a humoral response to toxin A and / or toxin B of C. difficile, thereby neutralizing, blocking, reducing, improving, curing or treating the disease associated with C. difficile, infection or CDAD in the individual . In another embodiment, the individual activates a cellular immune response to toxin A and / or toxin B of C. difficile. In another modality, the individual activates both a humoral and cellular immune response to toxin A and / or toxin B of C. difficile.
In another embodiment, the invention encompasses a method of neutralizing, inhibiting or blocking the activity of toxin A and / or toxin B on or against a cell susceptible to infection caused by C. difficile, which comprises contacting the cell with an antibody or an antigen-binding fragment thereof, in accordance with the present invention, wherein the antibody or antigen-binding fragment thereof neutralizes, inhibits or blocks the activity of toxin A and / or toxin B on or against cell through a competitive or mixed competitive action mechanism. In one embodiment, the antibody is one or more of a monoclonal antibody, a humanized antibody, or a chimeric antibody. In one embodiment, the cell is in an individual and the antibody or antigen-binding fragment of the cell is administered in an efficient amount to the individual. In one embodiment, the cell is within the gastrointestinal tract, for example, an intestinal epithelial cell, of the individual. In one embodiment, the toxin is toxin A. In one embodiment, the toxin is toxin B. In one embodiment, the toxin is toxin A and the antibody's mechanism of action is a competitive inhibition mechanism. In one embodiment, the toxin is toxin A and the antibody or antigen-binding fragment thereof is 10 PA-50 (ATCC Accession No. PTA-9694), a humanized form of the same or an antibody or fragment of the same, which competes with PA-50 for the neutralization activity of toxin A. In one embodiment, the toxin is toxin A and the antibody's mechanism of action is a mixed competitive inhibition mechanism. In one embodiment, the toxin is toxin A and the '15 antibody or antigen-binding fragment thereof is PA-39 (ATCC Accession No. PTA-9692), a humanized form of the same or an antibody or fragment of the same, which competes with PA-39 for the neutralization activity of toxin A. In one embodiment, the toxin is toxin B and the 3rd mechanism of action of the antibody is a mixed competitive inhibition 20 action mechanism. In one embodiment, the toxin is toxin B and the antibody or antigen-binding fragment thereof is PA-41 (ATCC Accession No. PTA-9693), a humanized form of it or an antibody or fragment of even, which competes with PA-41 for the neutralization activity of toxin B.
As used herein, the term competitive toxin inhibitor refers to a toxin neutralization inhibitor, for example, an antibody, an agent or a small molecule or a chemical entity, which exhibits an EC ₅₀ shift to the right on the curve neutralization, without a change in the maximum neutralization percentage as the toxin concentration increases in the culture. Thus, a competitive inhibitor is typically able to overcome the cytotoxic effect of the toxin by adding more inhibitor. The term non-competitive toxin inhibitor refers to a
109/183 toxin neutralization inhibitor that exhibits a decrease in the maximum neutralization percentage without a change in concentration, producing a half-maximum response (EC50) as the concentration of the toxin increases in the culture. Thus, a non-competitive inhibitor is typically unable to completely overcome the cytotoxic effect of the toxin by adding more inhibitor. The term mixed competitive toxin inhibitor refers to a toxin neutralization inhibitor that exhibits some degree of inhibition both competitive and non-competitive as the concentration of the toxin increases in the culture. For example, a mixed toxin competitive inhibitor 10 can bind to the toxin and exert its effect by blocking the toxin from binding to a cell, as well as by blocking other toxin cytotoxic effects; thus exercising a mixed competitive action mechanism.
Examples
Example 1
Production of neutralizing monoclonal antibodies against toxin A and / or toxin B of C. difficile
A, Preparation of the immunogenic agent
Neutralizing monoclonal antibodies directed against C. difficile toxin A and / or toxin B were generated by immunizing mice with C. difficile toxin A toxoid (inactive form of toxin) and with active forms of toxin A and / or toxin B. Murine mAbs (PA-38: antitoxin A mAb, ATCC # PTA-9888; PA-39: antitoxin mAb A and B, ATCC # PTA-9692; PA-41: antitoxin B mAb ATCC # PTA-9693; and PA-50: 25 mAb antitoxin A, ATCC # PTA-9694) were generated by immunizing animals with toxoid A followed by immunizations with the active form of toxin A and / or toxin B. toxin A, toxin A, toxin B (List Biological Laboratories Inc., Campbell, CA) and toxin A (Techlab Inc., Blacksburg, VA) were stored at 4 ° C until use. The toxins and toxoid 30 were derived from the VPI 10463 strain, a commonly used reference strain of C. difficile. Quil A adjuvant (Accurate Chemical, Westbury, NY) was added to the required volume of toxoid or toxin and mixed. THE
110/183 mixture was prepared within 60 minutes of immunizations and stored on ice until ready to immunize. For the final boost before fusion, the required toxin was diluted in PBS and stored on ice until used for immunization.
B. Immunization and fusion
Thirty females of BALB / c mice (Charles River Labs, Wilmington, MA) received two immunization doses (for PA-50) or three immunization doses (for PA-38, PA-39 and PA-41) of the toxin toxoid A (10 pg) subcutaneously at three-week intervals before receiving booster immunizations with increasing doses of active toxin A or active toxin B, also at three-week intervals. For PÁ-38, a mouse received a booster immunization every three weeks for a total of three boosters with toxin A (List Biological Laboratories Inc.), each booster with a dose increase of 500 ng up to 2 pg and a final booster of '15 toxin A (8 pg) three days before splenotomy. For PA-39 and PA-41, two mice received three or five booster immunizations, respectively, every three weeks with toxin B, each booster with an increase in dose from 2 pg to 12.5 pg and a final booster of toxin B (20 pg) three days before splenotomy. For PA-50, one mouse received 20 booster immunizations every three weeks for a total of four boosters with toxin A (Techlab Inc.), each booster with a 20 ng dose increase to 2.5 pg and a final booster. toxin A (10 pg) three days before splenotomy. The immunization and booster doses of toxoid and toxin, respectively, were administered in combination with adjuvant, for example, Quil A (10 pg). The reinforcement with the active form of toxin A or toxin B served to identify animals that may have developed protective antibodies. The serum of the immunized animals was serially diluted and tested for neutralization of the cytotoxic effect of toxin A on CHO-K1 cells as described below. Animals with the highest titer of neutralizing antibodies were chosen for fusions and boosted with toxin without adjuvant.
After reinforcement, the animals were sacrificed and the isolated splenocytes were fused with the Sp2 / 0 cell line, using standardized methods. Hybridomas were suspended in selection medium, RPMI-1640, 10% FBS, 10% BM Condimed-H1 (Roche Applied Science, Indianapolis, IN) and beta mercaptoethanol (for PA-38 and PA-39) or Hybridoma- SFM and 10% FBS (for PA-41 and PA-50) which contained 100 μΜ of 5 hypoxanthine, 1 pg / mL of azaserine and 16 μΜ of thymidine for selective pressure. Hybridomas were plated on 96-well flat-bottom tissue culture plates (BD Biosciences, San Jose, CA). The plates were incubated at 37 ° C for 3 days, followed by the addition of HT growth medium (the selection medium without azaserine). The incubation continued for another 10 4-7 days before checking the hybridoma supernatants for neutralization activity.
At the primary check for PA-38, 608 hybridoma supernatants were tested for their ability to neutralize the cytotoxic effect of toxin A (List Laboratories) on CHO-K1 cells (ATCC # CCL-61, • 15 Manassas, VA). At the primary check for PA-39 and PA-41, 2416 hybridoma supernatants were tested for their ability to neutralize the cytotoxic effect of toxin B (List Laboratories) on CHO-K1 cells. In the primary check for PA-50,1440 hybridoma supernatants were tested for their ability to neutralize the cytotoxic effect of toxin 20 A (Techlab Inc.) on T-84 cells. A second trial verified the inhibition of toxin-mediated agglutination of rabbit erythrocytes. Starting from the verification procedure, four mAbs, which were named PA-38 (antitoxin A), PA-39 (antitoxin A / B), PA-50 (antitoxin A) and PA-41 (antitoxin B) and which inhibited or neutralized efficiently the toxins of C. difficile 25 in the verification tests were isolated. The hybridoma cell lines that produced these mAbs were cloned twice by limiting dilution to generate clonal cell lines. The PA-38, PA-39, PA-41 and PA-50 mAbs were determined to be of the lgG2a, ü, lgG1, ü, lgG1, ü and IgGI.C isotype, respectively, using IsoStrip Mouse Monoclonal 30 Antibody Isotyping Kit ( Roche Applied Science, Indianapolis, IN). The mAb-producing hybridoma cell lines are called at least the name that the mAbs they produce.
112/183
C, Verification: neutralization of the cytotoxic effect of toxin A or B on cells
The hybridoma supernatants were checked for the ability to neutralize the cytotoxic effect of toxin A or toxin B on the 5 cells. A high-throughput method was developed to process thousands of hybridoma supernatants at once. The cytotoxicity assay used CHO-K1 cells (for PA-38, PA-39 and PA-41) or T-84 cells (for PA-50). The cells were added to the assay plates (translucent flat-bottom plates with a 96-well opaque white wall; Perkin Elmer,
Waltham, MA) using the Biomek FX robotic system (Beckman Coulter, Brea, CA). The assay plates were incubated for 4 hours at 37 ° C to allow the cells to adhere to the wells. For the T-84 assay, toxin A was diluted to 240 ng / mL. For the CHO-K1 assay, toxin A was diluted to 2 pg / mL or toxin B was diluted to 6 ng / mL. The diluted toxin was added to the reagent dilution plates (96-well rounded bottom plates; BD, Franklin Lakes, NJ) manually in a Biosafety Cabinet (BSC). Hybridoma supernatants were collected manually and added to the wells of reagent dilution plates using the Biomek FX system. The supernatant and the toxin mixture were incubated at
37 ° C for 1 hour and added to the assay plates containing the cells using the Biomek FX system. After incubation at 37'C for 72 hours, 20 µl / well of CelITiter-Blue (Promega, Madison, Wl) was added to each well. The plates were incubated for an additional 4 hours and then read on a SpectraMax M5 Plate Reader (Molecular Devices, Sunnyvale,
AC) using an excitation wavelength of 560 nm and an emission wavelength of 590 nm. Cell survival was compared in untreated and toxin-treated cultures. The percentage of cell survival was plotted against the concentration.
D. Production of murine mAbs of the invention
In vivo and in vitro production methods were used to obtain isolated and / or purified mAbs of the invention. For production
113/183 in vivo of murine mAbs, ascites fluid was prepared by injecting the appropriate hybridoma cell line into the peritoneal cavity of BALB / c mice initiated with pristane. The mAb was purified to> 95% homogeneity by precipitation with ammonium sulfate 5 followed by Protein A chromatography. The purified antibodies were resuspended in phosphate buffered saline (PBS).
For small-scale in vitro production (<100 mg), murine mAbs were purified from hybridoma supernatants grown in culture. Hybridomas were grown in Hybridoma-SFM (Invitrogen) and 10 10% FBS. Cell lines were passed and expanded in T-150 flasks three times weekly to ensure that the cell concentration did not exceed 2x10 ⁶ cells / mL. Supernatants containing PA-39 (IgG1, K), PA-41 (IgG1, K) and PA-50 (IgG1, K) were clarified by centrifugation at 2000 rpm for 10 minutes and filtered. The clarified material was diluted in a final concentration of running buffer (60 mM glycine / 3 M NaCI, pH 8.5) and loaded onto a protein A column balanced with running buffer. After washing the column, the PA-39 or PA-41 mAbs were eluted with 0.1 sodium acetate, pH 5.5 and neutralized at pH 7.0. Supernatants containing PA-38 (IgG2a, K) were clarified by 20 centrifugation at 2000 rpm for 10 minutes and filtered. The clarified material was adjusted to a final concentration of 25 mM sodium phosphate buffer / 100 mM NaCI, pH 7.0 and loaded onto a protein A column equilibrated with 50 mM sodium phosphate buffer / 0.5 M sodium chloride. NaCI. The column was washed; mAb PA-38 was eluted with 0.1 M sodium acetate, pH 3.0 and the eluted antibody was neutralized at pH 7.0.
For the in vitro production of large amounts of mAb (> 100 mg), hybridomas were inoculated into a WAVE Bioreactor (GE Healthcare, Piscataway, NJ) with an initial density of 2x10 ⁵ cells / mL of Hybridoma-SFM with 5% Ultra Low IgG FBS. Cell count and viability were monitored daily. Approximately on the 6th or 7th when the antibody production reached a plateau, the culture was terminated. The culture was clarified and was then concentrated 10-20 times by filtration with
114/183 tangential flow. The antibody was loaded onto a protein A column equilibrated with 60 mM glycine 3 M NaCI at pH 8.5. The column was washed with the same buffer and the antibody was eluted with 50 mM acetate, pH 3.5. The pooled antibody was neutralized at pH 7.4 with 1 M Tris, 5 concentrated to 10 mg / mL and diafiltered in PBS. The purified mAbs were sterilized by filtration and stored at -80 ° C.
Example 2
Specificity and affinity of mAbs antitoxin A and / or C. difficile toxin B of the invention to toxin A and / or toxin B
A. ELISA to determine the specificity of mAb for toxin A and / or toxin B
ELISA plates (BD Biosciences) were coated with 50 ng / well of toxin A (List Laboratories) or 25 ng / well of toxin B (List Laboratories) overnight at 4 ° C. After washing the plates with PBS 15 (PBS without calcium or magnesium, 0.05% Tween 20), the wells were blocked with 200 pL of blocking buffer (PBS without calcium or magnesium, 0.1% Tween 20, 2.5% skimmed milk) for one hour at 37 ° C. The washing step was repeated and the hybridoma supernatants or purified mAb were added over one hour at 37 ° C. The plate was washed and incubated for one hour at 37 ° C with goat mouse anti-Fc IgG, horseradish peroxidase (HRP) -conjugate (Jackson Immunoresearch, West Grove, PA). The plate was developed with the ABTS peroxidase substrate system (KPL, Gaithersburg, MD), with ABTS peroxidase termination solution (KPL) and read in a SpectraMax plate reader (Molecular De25 vices) at 405 nm.
The titration data are shown in Figs. 1A-C. Fig. 1A demonstrates that PA-38 binds to toxin A and not to toxin B. Fig. 1B demonstrates that PA-39 can bind to both toxin A and toxin B. Fig. 1C demonstrates that PA-41 binds to toxin B and not toxin A.
B. Reactivity of mAbs to toxins A and B in Biacore
A Biacore 3000 instrument (GE Healthcare) was used to determine the specificity of mAbs binding of the invention to toxin A and / or
115/183 to toxin B. MAbs were immobilized to approximately 10,000 resonance units (UK) on CM5 sensor chips (GE Healthcare) according to the manufacturer's instructions for amine coupling. An antibody reference surface combined with the isotype of irrelevant specificity (Southern Biotech) was used as a control. The binding experiments were carried out at 25 ° C in HPSES-based HPS-EP buffer (GE Healthcare). Purified toxin A or purified toxin B (30 nM; List Biological Laboratories) was passed through the control and the test flow cells at a rate of 5 pL / min. When indicated, the additional mAb (100 nM) was then passed through the flow cell at 5 pL / min to check for multivalent or competitive binding.
As shown in Figs. 2A-D, mAb PA-38 (Fig. 2A) and mAb PA-50 (Fig. 2C) specifically bind to toxin A; mAb PA-41 (Fig. 2D) binds specifically to toxin B; and mAb PA-39 (Fig. 2B) binds preferentially to toxin A, but also demonstrated binding to toxin B. The results of these data are consistent with the ELISA data (Figs. 1A-C) and demonstrate the specificities of binding mAbs of the invention to toxin A and / or toxin B.
C, Binding affinity
Biacore analysis was also used to determine the avidity of binding the invention's mAbs to their respective toxins. The mAb was captured using a CM5 sensor chip prepared with a Biacore mouse antibody capture kit. The toxin was then passed through the flow cells in varying concentrations (0.4 -100 nM, two-fold increase). All concentrations of toxin were tested in duplicate and the chip surface was regenerated after each run using the conditions specified in the kits. Changes in UR were recorded and analyzed using Bia Evaluation Software 1: 1 (Langmuir) binding model that calculated the Kd of the mAb for the toxin. The association and dissociation and adjustment data are illustrated in Figs. 3A-E.
The Kd of the mAbs for toxin A was determined by Biacore analysis to be 1.0 nM for PA-38, 0.16 nM for PA-39 and 0.16 nM for PA-50. The AK _D of mAbs for toxin B was determined to be 2.4 nM for PA-39 and 0.59 nM for PA-41. These results demonstrated that the mAbs of the invention bound to toxin A and / or toxin B with nanomolar and subnanomolar affinities.
Example 3
In vitro cell-based neutralization tests
Cell-based cytotoxicity assays employing CHO-K1 cells or T-84 cells were used to evaluate the neutralization activities of the anti-toxin A and anti-toxin B mAbs described.
A. Neutralization of the cytotoxic effect of toxin A in CHO-K1 cells
CHO-K1 cells were seeded (2,000 cells in 50 pL / well) in the assay plates (translucent flat-bottom plates with a 96-well opaque white wall (Perkin Elmer)). The cells were allowed to adhere for 4 hours before treatment. Equal volumes (35 μΙ_) '15 of 2 pg / mL toxin A (List Biological Laboratories) and serial diluted mAbs were mixed in reagent dilution plates (96-well round bottom plates (Falcon)) for 1 hour at 37 ° C and then 50 µl of the mixture was added to each well of the plates. After incubation for 72 hours, 20 µl / well of CelITiter-Blue (Promega) 20 µl were added to each well. The plates were incubated for an additional 4 hours, then read on a SpectraMax M5 Plate Reader (Molecular Devices) using an excitation wavelength of 560 nm and an emission wavelength of 590 nm. Cell survival was compared in untreated and toxin-treated cultures. The percentage of cell survival was plotted against the mAb concentration. Inhibition data were fitted to the sigmoidal dose response curve with non-linear regression using the GraphPad Prism software and the concentration of mAb required for 50% cytoxicity neutralization (EC ₅ o) was calculated. As shown in Fig. 4, mAb PA-39 completely neutralized toxin A activity in CHO-K1 cells with an EC ₅₀ of 93 pM.
B · Neutralization of the cytotoxic effect of toxin B in CHO-K1 cells
117/183
A CHO-K1 cytotoxicity assay was used to assess the neutralization activity of specific antitoxin B mAbs. Similar to the evaluation of antitoxin A mAbs, toxin B (8 pg / mL, TechLab) was incubated for 1 hr at 37 ° C with serially diluted mAbs prior to addition to CHO-K1 (2,000 cells / well) in a 96 wells. After 72 hours, 20 pL / well of CellTiter-Blue (Promega) was added to each well. The plates were incubated for an additional 4 hours and then read on a SpectraMax M5 Plate Reader (Molecular Devices) using an excitation wavelength of 560 nm and an emission wavelength of 10 590 nm. Cell viability was determined using CellTiter-Blue; cell survival was compared between treated and untreated cultures. Inhibition data were fitted to the sigmoidal dose response curve with non-linear regression using the GraphPad Prism software and the concentration of mAb required for 50% cytoxicity neutralization (EC ₅₀ ) '15 was calculated. As shown in Fig. 5, PA-41 demonstrated a high degree of activity (an EC50 of 9.2 pM) in neutralizing toxin B cytotoxicity in CHO-K1 cells.
Although mAb PA-39 demonstrated binding to toxin B based on ELISA and Biacore analyzes, this mAb had no in vitro activity 20 against toxin B in CHO-K1 and other cell-based assays. Antibodies that bind to both toxin A and toxin B, but lack functional activity in neutralizing toxin A or toxin B in in vitro cell-based assays have been reported (46, 92 and 93). The present invention encompasses a new mAb that has the dual ability to bind both toxin A and toxin B and also to neutralize the cytotoxicity of a C. difficile toxin, that is, toxin A.
C. Neutralizing the cytotoxic effect of toxin A on T-84 cells
A T-84 cytotoxicity assay was used to assess the neutralization activity of the described antitoxin A mAbs. T-84 30 cells were seeded (15,000 cells in 50 pL / well) on assay plates (translucent flat-bottom plates with 96-well opaque white wall (Perkin Elmer)). The cells were allowed to adhere for 4 hours
118/183 before treatment. Equal volumes (35 pL) of 240 ng / mL toxin A (Techlab) and serial diluted mAbs were mixed in reagent dilution plates (96-well round bottom plates (Falcon)) for 1 hour at 37 ° C and then 50 µl of the mixture was added to each well of the 5 assay plates. After incubation for 72 hours, 20 pL / well of CellTiter-Blue (Promega) was added to each well. The plates were incubated for an additional 4 hours, then read on a SpectraMax M5 Plate Reader (Molecular Devices) using an excitation wavelength of 560 nm and an emission wavelength of 590 nm. Cell survival was compared in untreated and toxin-treated cultures. Inhibition data were fitted to the sigmoidal dose response curve with non-linear regression using the GraphPad Prism software and the concentration of mAb required for 50% cytoxicity neutralization (EC ₅₀ ) was calculated. As shown in Fig. 6, mAbs PA-38 and PA-50 15 completely neutralized toxin A activity in T-84 cells with an EC ₅ of 175 pM and 146 pM, respectively. In the T-84 cell assay, mAb PA-39 demonstrated minimal activity against toxin A and PA-41 was not active.
D. Rabbit red blood cell (RBC) hemagglutination
The ability of the mAbs of the invention to block binding of toxin A to cell receptors was assessed using a hemagglutination assay. For this assay, equal volumes of (30 pL / well) of toxin A (8 pg / mL; TechLab) and serial diluted mAbs were mixed in reagent dilution plates (96-well round bottom plates (Falcon)) 25 for 1 hour at 4 ° C. Red rabbit blood cells (RBC) (Colorado Serum Co., Denver, CO) were washed with PBS three times and resuspended in PBS. 60 µl of a 1% RBC suspension was added to the wells of 96-well plates containing the toxin A-mAb mixture and the plates were incubated at 4 ° C for 4 hours. Free toxin A 30 causes hemagglutination of RBC. Consequently, the addition of anti-toxin A mAb that binds toxin A is expected to prevent hemagglutination. The extent of hemagglutination was determined using an instrument
119/183
ImageQuant 400; complete hemagglutination provided a stronger signal compared to suspended RBC. EC50 values were calculated from the inhibition data using the adjustment of the sigmoidal dose response curve with non-linear GraphPad Prism regression. As shown in Fig. 7, mAb PA-38 (filled squares) and mAb PA-50 (filled triangles) completely neutralized toxin A activity in RBCs with an EC50 of 30 nM and 1.8 nM, respectively. PA-38 and PA-50 appear to neutralize toxin A by blocking the binding of toxin A to its receptor. It was observed that mAbs PA-39 and PA-41 were inactive in the output.
E. Caco-2 monolayer assay
Caco-2 cells were seeded (25,000 cells at 75 μL / well) in the upper chamber of the 96-well Caco-2 Multiscreen plates (Millipore Billerica, MA) with 250 pL of medium added in the lower chamber. The cells were allowed to grow for 10 days with regular changes of medium every 3-4 days. After a 10-14 day incubation, the formation of a compact monolayer was confirmed by measuring the transepithelial electrical resistance (TEER) using an epithelial voltohmometer (model: EVOMX, World Precision Instruments, Sarasota, FL). After the monolayer integrity was established and determined, equal volumes (60 pL) of toxin A (at 50 ng / mL) and serially diluted mAb were mixed for 1 hour at 37 ° C and then added to the upper chamber of the breadboard. The plates were incubated for 18-24 hours and then the TEER value was measured using the voltohmometer. The integrity of the knockout mo25 was compared in untreated and toxin-treated wells.
As shown in Fig. 8, the inhibition data fitted a sigmoidal dose response curve with nonlinear regression using the GraphPad Prism software to determine the concentration of mAb required for 50% neutralization (EC ₅₀ ). The PA-38 and PA-50 mAbs neutralized the ingestion of Caco-2 monolayers by toxin A with an EC ₅₀ of 485 pM and 196 pM, respectively. The other mAbs were found to be inactive in this assay.
120/183
Although it is not desired to be bound by theory, cell-based in vitro results demonstrate that PA-38 and PA-50 appear to represent a class of antitoxin A mAbs, while PA-39 represents another class of antitoxin A mAbs. PA- 38 and PA-50 appear to bind to 5 an epitope of toxin A important for binding to the receptor; mAb PA-39 appears to bind to the toxin in a way that most directly blocks the cytotoxic effects of toxin A in vitro.
Example 4
Evaluation of the in vivo efficacy of mAbs antitoxin A and toxin B of C. difficile 10 of the invention in mice
An in vivo mouse model was used to measure the ability of the mAbs described here to neutralize circulating C. difficile toxins in an animal. The in vivo neutralization activities of PA-38, PA-39, PA-41 or PA-50 mAbs, administered alone or in combination, were tested against the effects of combined systemic toxin A and C. difficile toxin B (Techlab) in test animals.
Females of 4-6 Swiss Webster mice / group (age: ~ 6-8 weeks at baseline; Charles River Laboratories) were used in the experiments. The mice were acclimatized in the unit for a minimum of 4 days for 20 and the animals' health was checked before use. Animal experiments were conducted under the protocol approved by IACUC.
The initial experiments were carried out to determine the toxicity of toxin A and toxin B in mice. The animals received 25 doses at 0, 20, 100, 500, 2500 ng of toxin / animal intraperitoneally (i.p.) and a dose that was lethal to the animals was selected for use in subsequent antibody neutralization experiments. Control mice injected with PBS were unaffected. A 100 ng dose of toxin A (TechLab) was selected for the neutralization experiments, since this was the lowest dose level observed to be lethal to 100% of the mice within 24 hours after injection. Similarly, a 100 ng dose of toxin B (TechLab) was selected for
121/183 neutralization experiments, since it was the lowest dose level observed to be lethal for 100% of the mice within 24 hours after injection.
To assess the neutralizing activity of the antitoxin mAbs, 5 a single injection of each mAb at different dose levels was administered i.p. to mice (5 per group) on day 0, followed by i.p. 100 ng / 200 DL of toxin A or toxin B on day 1. Animals were observed daily for three days and then weekly for up to 21 days after administration of the toxin. Animal survival was the primary end point of the study.
For neutralization experiments, all doses of antibody were formulated in PBS without calcium or magnesium (PBS-, Invitrogen, Carlsbad, CA). A single injection of mAb PA-38, PA-39, PA-41 or PA-50 at different dose levels was administered i.p. (200 Cl / dose / animal) to 15 mice on day 0, followed by injection of the toxin (ip at a different site from the injection site of the antibody) on day 1. The health condition of the animals was monitored daily for the first 3 -4 days and then twice a week for up to 21 days after toxin administration. Observations next to the animals' cages (for example, cold air posture, dull coat, inactivity) were recorded, as well as survival.
Different dose levels of PA-38 (0.2 pg to 250 pg per animal) and PA-50 (0.2 pg to 100 pg per animal) were assessed. In this model, it was observed that PA-38 and PA-50 neutralized a dose of 100 ng 25 of toxin A and enabled 100% survival at dose levels as low as 2 pg of mAb per animal as shown in Figs. 9A and B. In contrast, a human monoclonal antibody comparing antitoxin A (WO / 2006/121422 and US2005 / 0287150), referred to here as the CDA-1 comparator mAb, at 5 pg per animal, did not protect animals from death related to the toxin as did the mAbs of the invention (Fig. 9C). Doses of PA-41 ranging from 0.5 pg to 250 pg were evaluated and it was observed that a single dose of 5 pg of mAb per animal completely neutralized
122/183 a 100 ng dose of toxin B toxicity in animals as shown in Fig. 10. It was not observed that MAb PA-39 (100 pg per animal) provided a delay in mice toxin-related death for the toxin A or B.
After the activity of neutralizing individual antibodies against toxin A (PA-38, PA-50) or against toxin B (PA-41) was clearly demonstrated in vivo, an experiment was carried out to test the combination of mAbs (PA -38 + PA-41) at dose levels of 5 and 50 pg of each mAb against a combined lethal dose of toxins (100 ng toxin A and 10 100 ng toxin B) in the same mouse model in vivo. In addition, individual monoclonal antibodies were included as controls. As shown in Fig. 11, a combination of the PA-38 and PA-41 mAbs showed protection from the combination of toxins at both 5 „0 pg / animal (4 out of 5 survived) and 5 pg / animal (1 out of 5 survived) compared to the '15 activity of each mAb alone (all animals died within 24 hours of toxin administration).
Example 5
Evaluation of antitoxin A mAbs and C. difficile toxin B of the invention in the C. difficile-associated diarrhea (CDAD) model in Golden S20 yrian hamsters
The CDAD model in hamsters reproduces the key aspects of CDAD disease in humans. After treatment with antibiotics, normal colonic flora is eradicated and hamsters become more quickly susceptible to infection by C. difficile. The infection results in severe diarrhea, 25 pseudomembranous colitis and death. The hamster CDAD model was used to assess the potential efficacy of the mAbs of the invention to prevent disease and death associated with the challenge of live C. difficile bacteria animals. These experiments were conducted under the protocols approved by IACUC.
A. Pharmacokinetic analysis
Before carrying out the efficacy study on the hamster model using hamsters infected with live C. difficile microorganisms, a study
123/183 all of the pharmacokinetics were performed on normal uninfected hamsters. Golden Syrian Hamsters (Harlan) received intraperitoneal injection with 0.2 mg / animal or 1 mg / animal of mAb PA-38 or purified mAb PA-41. Blood samples were collected using blood extraction techniques by retroorbital or cardiac (terminal) perforation in 0.125, 0.25, 1, 2, 4, 7, 10, 14 and 21 days. Blood samples were centrifuged at 8000 rpm for 10 minutes to obtain the serum.
The concentration of mAb in the serum was determined by ELISA. Ninety-six well ELISA plates (BD Biosciences) were coated overnight with toxin A (Techlab) or toxin B (Techlab) at 250 ng / well at 4 ° C. The plates were washed three times with PBS / 0.05% Tween-20® (PBS-T) and blocked with 200 µL of blocking buffer (PBS without calcium or magnesium, 0.1% Tween 20®, 2, 5% skim milk) for one hour at room temperature. The antibody reference standard (mAb PA-38 or purified mAb PA-41) was diluted in 1% naive hamster serum pooled to generate a standard curve with a range of 0.3-1000 ng / mL. The diluted test samples and standards were incubated for one hour at room temperature.
The plates were washed (as before) and incubated for one hour at room temperature with goat anti-goat IgG conjugated to HRP, specific for FcD (Jackson Immunoresearch). The plates were developed with the ABTS peroxidase (KPL) substrate system, interrupted with the ABTS peroxidase (KPL) termination solution and read in a SpectraMax plate reader (Molecular Devices) at 405 nm. The concentration of mAb in each hamster at different time points was calculated using standard curves. Approximately 10% of the samples had no antibody titer, probably due to a missed injection or no absorption; these samples were not included in the calculation of the PK parameters. Non-compartmental pharmacokinetic analysis was performed using WinNonLin, Version 4.0 (Pharsight Corp., Mountain View, CA) and the data are illustrated in Table 1 and Figs. 12A and B. As indicated, Cmax and area under the curve (AUC) are dose dependent. Each one
124/183 of the antibodies demonstrated a terminal half-life greater than 6 days, which guaranteed antibody retention in the efficacy studies described here below.
Table 1. PK parameters of mAbs in hamsters
mAb AUC | NF_obs (day * pg / mL) Tmax (d'a) Cmax (pg / mL) Half lifex (day) Rsq PA-38 2mg / kg 303.8 2.00 25.2 7.4 0.999 PA-38 10mg / kg 1522.6 0.25 128.0 10.6 0.988 PA-41 2mg / kg 202.2 0.25 20.5 6.2 1,000 PA-41 10mg / kg 696.7 1.00 78.1 6.8 1,000
B. Evaluation of anti-toxin A mAbs and C. difficile toxin B of the invention, in combination, in the C. difficile-associated diarrhea (CDAD) model in Golden Syrian hamsters
An efficacy experiment was carried out to evaluate the murine antitoxin A and antitoxin B mAbs of the invention in relation to their ability10 to affect the survivability of infected animals in a model of diarrhea associated with C. difficile in vivo in hamsters. Males of Golden Syrian hamsters (~ 90g) (Crl: LVG (SYR)), (Charles River Laboratories, Inc., Kingston, NY) were pretreated with a single subcutaneous dose of clindamycin (Sigma, St. Louis, formulated in 5 mg / mL PBS) at 50 mg / kg 15 to disturb normal colonic flora. The following day, hamsters in the relevant test groups received an oral dose (1 x 10 ⁷ CFU in 0.5 mL) of a suspension of C. difficile (ATCC 43596 strain). The 43596 strain was previously used in hamster models for the evaluation of neutralizing antibodies. The animals were weighed weekly and monitored daily for health status and survival.
The test antibodies comprised combinations of the murine mAbs of the invention, that is, a combination of PA-38 and PA-41 or
125/183 a combination of PA-39 and PA-41 mAbs. Goat antibodies anti-toxin A and polyclonal C. difficile toxin B (Techlab) were included as a positive control. Control mAbs and reagents were administered as described in Table 2.
Table 2. Treatment groups in the study of efficacy in hamsters.
Grp Treatment Dose (mg / kg) Route Programming No. of hamsters 1 Not infected AT* AT AT 4 2 Uninfected + clindamycin AT AT AT 4 3 Infected control AT AT AT 8 4 Vancomycin 20 POWDER IDB X 5 days 8 5 Polyclonal goat abs 1 mL / ham ster IP Q2dX4 8 6 PA-38 + PA-41 50, 50 IP Q2dX4 8 7 PA-39 + PA-41 50, 40 IP Q2dX4 8
*Not applicable.
The hamsters in Group 1 did not receive treatment throughout the study. The hamsters in Groups 2-7 were pretreated with a single subcutaneous dose of clindamycin phosphate at 50 mg / kg (Day -1). The hamsters in Groups 5-7 received a dose with polyclonal goat antibodies (Group 5) or with combinations of mAb (Groups 6 and 7) as shown in Table 2 through ip administration immediately after treatment with clindamycin. After 24 hours, each hamster in Groups 3-7 was inoculated with 0.5 mL of the appropriate suspension of C. difficile ATCC 43596 (10 ⁶ -10 ⁷ CFU / mL) via forced oral ingestion (day 0). After initial treatment with antibodies on day -1, the three subsequent treatments for these groups were administered on alternate days, once daily, on days 1, 3 and 5. Vancomycin (20 mg / kg BID) was administered via forced oral intake of animals in Group 4 twice daily, approximately 6 hours apart on days 1-5. The administration of vancomycin (animals of the
126/183
Group 4) started approximately 20-24 hours after the animals were inoculated with C. difficile.
The survival results for the mAb-treated and control groups are illustrated in Fig. 13. A summary of 5 hamster mortality for all groups is shown in Table 3. It was observed that all hamsters infected with C difficile without any treatment (infected control, Group 3) died on day 2 or day 3 of the study. In the vancomycin-treated group (Group 4), seven out of eight hamsters were found dead between days 15 and 19. As is typically observed in this model, the majority (88%) of vancomycin-treated hamsters suffered recurrence and died of infection caused C. difficile within two weeks after discontinuation of therapy. In contrast, all hamsters treated with the PA-39 + PA-41 mAbs combination (Group 7) and 7 of 8 hamsters treated with the PA-38 + PA-41 mAbs combination (Group 6), - 15 survived until the end of the study (37 days post-infection). In addition, at the end of the study, all animals in the group treated with goat polyclonal antibodies (Group 5) were alive. All surviving hamsters had normal Gl tracts at postmortem necropsy (see Figs. 15A, C and D).
Table 3. Mortality rate and day of death of the hamster in each group
Grp Treatment No. of animals % of mortality Study Day 2 3 5 7 15 18 19 37 1 Not infected 4 0 2 Uninfected * Clindamycin 4 50 1 1 3 Infected control 8 100 5 3 4 Vancomycin 8 88 1 5 15 Polyclonal goat abs 8 0 6 PA-38 + PA-41 8 131 7 PA-39 + PA-41 8 0
These results indicate that the combination of PA-39 and mAbs
PA-41 and the combination of PA-38 and PA-41 mAbs efficiently and durably protected hamsters from serious illness, both initially and from
127/183 subsequent recurrence of the disease. The duration of the benefit of treatment with mAb (37 days) significantly exceeded the window (two weeks) for the establishment of infection caused by C. difficile after treatment with clindamycin in the hamster model.
The body weights of the animals in the groups treated with polyclonal and mAbs and in the control groups are illustrated in Fig. 14. The hamsters in the uninfected control group (Group 1) gained weight regularly, ranging from 13-29 g over the course of the study. All infected control animals died before the first post-inoculation weight measurement. The average body weights of animals treated with vancomycin, goat polyclonal antibodies, the mAb PA-38 + PA-41 combination and the mAb PA-39 + PA-41 combination decreased significantly during the first week after infection. After that, the average body weights in the groups treated with mAb, as well as in the group treated with polyclonal antibody, increased regularly and were similar to those of the uninfected control until the end of the study, indicating that there was no evident toxicity.
In general, in this study with hamsters, it was demonstrated that the combinations of mAbs of the invention efficiently and durably protected hamsters from mortality in a relevant and rigorous hamster model of infection caused by C. difficile. These findings support a mechanism by which mAb combinations protected animals from C. difficile disease for a period of time long enough to allow normal intestinal flora to grow and repopulate in animals treated with mAb compared to animals. not infected (Figs. 15A-D). Thus, the mAbs of the invention provided therapeutic protection for infected animals and made the resolution of the disease associated with C. difficile, the restoration of gastrointestinal health and survival.
Evaluation of individual C. difficile mAbs antitoxin A and / or toxin B of the invention in the C. difficile-associated diarrhea (CDAD) model in Golden Syrian hamsters
128/183
An additional study in hamsters was carried out to evaluate the effectiveness of individual murine mAbs of the invention administered to infected animals compared to that of the mAbs administered in combination. The treatment groups for this study are shown in Table 4.
Table 4. Study of the effectiveness in hamsters of individual mAbs compared with a combination of mAbs
Grp Treatment Dose (mg / kg) Route Programming No. of hamsters 1 Infected control NA ¹ AT AT 7 2 Vancomycin 20 POWDER IDB X 5 days 7 3 PA-39 + PA-41 50, 50 IP Q2dX4 7 4 PA-41 50 IP Q2dX4 7 5 PA-38 50 IP Q2dX4 7 6 PA-39 50 IP Q2dX4 7 7 PA-50 50 IP Q2dX4 7
¹ Not applicable.
In this study, hamsters in Groups 1-7 were pre-treated with a single subcutaneous dose of clindamycin phosphate at 50 mg / kg (day 1Ó -1). Animals in Groups 3-7 received a dose of mAbs by i.p. immediately after treatment with clindamycin. After 24 hours, each hamster in Groups 1-7 was inoculated with 0.5 mL of the C. difficile suspension via forced oral ingestion (day 0), as described in Section B, above. Test mAb treatments were administered to animals in 15 Groups 3-7 in a single dose on days 1, 3 and 5. Vancomycin was administered to animals twice daily on days 1-5 (Group 2). The hamsters were observed twice a day for viability. Body weights were recorded once a week. A necropsy was performed on animals that were found dead or euthanized 20 during the study. At the end of the study (40 days after inoculation), a terminal necropsy was performed on all remaining hamsters.
The survival of groups of animals treated with mAb and control is shown in Fig 16A and the day of death for hamsters in
129/183 all groups are summarized in Table 5.
Table 5. Mortality data and day of death
Grp Treatment No. of hamsters % of mortality Study Day 2 3 4 8 11 12 14 15 18 19 40 1 Infected control 7 100 7 2 Vancomycin 7 1001 2 1 1 23 PA-39 + PA-41 7 1414 PA-41 7 100 6 15 PA-38 7 100 5 26 PA-39 7 100 1 1 1 2 1 17 PA-50 7 100 3 4
In the infected control group (Group 1), all seven hamsters were found dead on day 2. All of these hamsters had
Gl inflamed on post-mortem examination. In the vancomycin-treated group (Group 2), all seven hamsters died between days 12 and 19 of the study. The timing of these deaths was similar to the timing that was observed previously with vancomycin treatment in this model. The post-mortem examination indicated that all hamsters had inflamed Gl tracts, indicating an infection caused by C. difficile.
The combined treatment with PA-39 + mAb PA-41 (Group 3) was very efficient! protection of hamsters infected in this study. Six of the seven hamsters in Group 3 survived the end of the study. A hamster was found dead on day 12 of the study. Post-mortem examination indicated that this hamster had an inflamed Gl tract, typical of infection caused by C. difficile.
Among treatments with a single antibody (Groups 4-7), mAb PA-39 alone (Group 6) exhibited some protective activity in treated animals. Hamsters in this group were found dead on days 20 2 to 12. In groups treated with individual mAbs, PA-41 (Group 4),
PA-38 (Group 5) or PA-50 (Group 7), the hamsters were found dead on days 2 and 3. At the final necropsy, all hamsters in these groups ti
130/183 have inflamed Gl tracts, which is indicative of infection caused by C. difficile. In contrast, all treated hamsters that survived had normal Gl treatments.
The results of this study indicate that treatment with the combination of PA-39 + PA-41 mAb successfully protected the hamsters against disease development for more than a month after the end of treatment and are the same as those obtained in the study described above. Example 5B, in which eight out of eight hamsters treated with the PA-39 + PA-41 combination survived the infection caused by C. difficile. 10 In this study, mAb PA-39, as a treatment with a single mAb, exhibited some activity in protecting hamsters infected with C. difficile against disease caused by C. difficile.
D. Determination of antibody concentrations from terminal blood and evaluation of the existence of C. difficile in terminal samples of 15 hamster caecuses
Blood was collected from animals that were dying during the study. At the end of the study, blood was also collected from all animals that remained alive. Blood samples were processed to collect the serum, unless otherwise mentioned below. The processed samples were frozen at <-70 ° C for possible further analysis.
After the in vivo efficacy studies in hamsters described above, the presence of mAbs was examined in terminal blood samples from animals in the studies. For the mAb combination study described in Example 5B, blood collection from eight of the animals in Group 7, which 25 had received a dosage (Q2d x 4) of a combination of PA-39 mAb (50 mg / kg) + mAb PA-41 (40 mg / kg) was performed terminally on day 37 of the study. In serum collected from this terminal blood collection, PA-39 was detected at a level of 3.3 ± 3.4 pg / mL and PA-41 was detected at a level of 2.4 ± 1.7 pg / mL. For the individual mAb study described in Example 30 5C, blood was collected from six of the animals in Group 3, which had received a dosage (Q2d x 4) of a combination of PA-39 mAb (50 mg / kg) + mAb PA-41 (50 mg / kg) was performed terminally on day 40 of the study and
131/183 the blood sample was processed to obtain the plasma. In plasma collected from this terminal blood collection, PA-39 was detected at a level of
1.8 ± 1.4 pg / mL and PA-41 was detected at a level of 3.4 ± 3.2 pg / mL. The antibody detection limit in these analyzes was 1.6 ng / mL. Thus, detectable levels of mAbs were measured in the animals over a period of several weeks. This supports a mode of action in which these mAbs confer a therapeutic benefit during the course of a treatment regimen and after the last doses of the mAbs are administered.
At the Group 3 terminal necropsy in Example 5C, the caecum of 10 each hamster was exposed and each looked normal. No inflammation or redness was observed and the contents of the caeca were relatively firm in consistency. The wall of each caecum was cut with a sterile disposable scalpel. A new scalpel was used for each hamster to prevent cross-contamination. A small amount of feces was removed from each caecum with a sterile cotton swab and placed in a sterile test tube. A 10 DL inoculation loop was used to collect a sample of faeces from the tube and streak the sample onto an agar slide containing CCFA with horse blood medium (Remei, Lot 735065), which is selective for C. difficile . The slides were placed in an anaerobic chamber and incubated for 48 hours at 37 ° C. One slide was received a streak of C. difficile ATCC 43596 from the stock culture and incubated with fecal stripes for colony comparison. Colonies resembling C. difficile were observed on the plates of all six hamsters. The results of these experiments indicate that, although the surviving animals treated with mAbs of the invention still had C. difficile, their normal flora had been re-populated in order to restore the microbial balance of the normal intestine, which contributes to their overall survival.
E. Evaluation of humanized mAbs antitoxin A and / or toxin B of C. difficile in the model of diarrhea associated with C. difficile (C. D / 'ffic / 7e-Associated Diar30 rhea - CDAD) in Golden Syrian hamsters
Another study in hamsters was conducted to assess the in vivo efficacy of a combination of humanized mAbs antitoxin A and mAbs
132/183 antitoxin B of the invention compared to that of a combination of comparative human antitoxin A mAb, CDA-1, and comparative human antitoxin B mAb, CDB-1, when the respective antibody combinations were administered to animals infected with C. difficile . The treatment groups for this study are shown in Table 5A.
Table 5A. Treatment groups in the comparative study of efficacy in hamsters.
Group Treatment Dose (mg / kg) Via Scheme No. of Hamsters 1 Uninfected control NA ¹ AT AT 4 2 Infected control AT AT AT 8 3 Vancomycin 20 IDB IDB X 5 days 8 4 hPA-41 + hPA-50 50, 50 IP Q2dX4 10 5 hPA-41 + hPA-50 20, 20 IP Q2d X 4 10 6 CDA-1 + CDB-1 50, 50 IP Q2dX4 10 7 CDA-1 + CDB-1 20, 20 IP Q2dX4 10
¹ Not applicable.
The test antibodies comprised combinations of the humanized mAbs of the invention, i.e., a combination of humanized anti-toxin A mAb PA-50 and humanized anti-toxin B mAb PA-41 (hPA-41 + hPA-50) or a combination of human anti-toxin A mAb comparative mAb referred to as comparative CDA-1 mAb and comparative human antitoxin B mAb referred to as comparative CDB-1 mAb (CDA-1 + CDB-1) in the amounts indicated in Table 5A. Comparative mAbs were synthesized (DNA2.0) based on published 3D8 and 124 heavy and light chain regions (WO2006 / 121422 and US2005 / 0287150), cloned into full-length lgG1 expression vectors (pCON-gamma and pCON-kappa), expressed in CHO-KSV1 cells and purified using the methods described here. Treatments with combinations of mAb and control were administered as described in Table 5A.
The treatment methods were essentially as described for Part B of this Example, supra. Briefly, Gol133 / 183 den Syrian hamsters (Charles River Laboratories, Stone Ridge, NY, 50 days old) were used in this study of Example 5E. The hamsters in Control Group 1 were not infected (and untreated). Animals in Groups
2-7 were pretreated with a single subcutaneous dose of 50 mg / kg clin5 damycin phosphate until disruption of normal colonic flora (Day -1). Animals in Groups 4-7 received the dose via IP administration immediately after treatment with clindamycin. After 24 hours, each animal in Groups 2-7 was inoculated with 0.5 ml of C. difficile suspension (ATCC 43596, strain 545) via forced oral ingestion (Day 0), (ie, oral dose). Additional additions of test treatments were given to animals in Groups 4-7 in a single dose on days 1, 3 and 5. Vancomycin was administered to animals in Group 3 twice daily, with an interval of approximately 6 hours, on days 1-5. The animals were weighed weekly and monitored daily for health status and over * 15 experience for 39 days. Necropsy was performed at the end and cecal titrations of C. difficile microorganisms were determined after anaerobic culture at 37 ° C for 48 hours in selective medium. The detection limit was 20 CFU / g of caecal content. This study and the hamster studies described above were conducted at Ricerca Biosciences (Concord, OH) in accordance with the guidelines of the Institutional Animal Care and Use Committee.
Survival results for the mAb-treated and control groups are illustrated in Fig. 16B-1. Mortality data for the study are shown in Table 5B below. A summary of hamster survival is shown in Table 5C below.
134/183
Table 5B. Mortality data and day of death of hamsters in each group
Group Treatment No. ofanimals %mortality Study Day 2 3 5 8 11 to 14 18 to 20 22 30 1 Uninfected control 4 0 2 Infected control 8 100 7 1 3 Vancomycin 8 100 1 5 24 hPA-50 + hPA-41 50, 50 mg / kg 10 10 1 5 hPA-50 + hPA-41 20, 20 mg / kg 10 0 6 ComparativeCDA-1 + CDB-1 50, 50 mg / kg 10 100 18 1 7 ComparativeCDA-1 + CDB-1 20.20 mg / kg 10 100 28
As noted in Table 5B, all 4 uninfected control hamsters (Group 1) survived at the end of the study. All 5 infected control animals (Group 2) died on days 2 and 3. In the group treated with vancomycin (Group 3), all study animals died between days 13 and 22. For Group 4 with hPA-50 + hPA-41 (50, 50 mg / kg), nine out of ten animals survived at the end of the study. A hamster in this group was found dying on day 8, with red discoloration of the Gl tract, while the nine remaining surviving animals in this group had normal Gl tracts. All ten hamsters in Group 5 survived the end of the study with normal Gl tracts. In the groups with comparative mAb, nine out of ten animals dosed with 50 mg / kg (Group 6) died among the
135/183 days 5 and 14; one animal died on the 28th day of the study. All ten hamsters treated with 20 mg / kg of the comparative mAb combination (Group 7) died between days 5 and 14 of the study.
Table 5C. Median and overall survival of animals treated with humanized mAbs 5 of the invention and comparative mAbs
Group / Treatment. Dose (mg / kg) Median survival (Days) SurvivalDay 40 (%) Group 1Not infected AT* 40 100 Infected Group 2 AT* 2 - 0 Group 3 Vancomycin 20 20 0 Group 4 hPA-50 + hPA-41 50, 50 AT 90 Group 5 hPA-50 + hPA-41 20, 20 AT 100 Group 6CDA-1 + CDB-1 50, 50 14 0 Group 7CDA-1 + CDB-1 20, 20 11 0
* Not applicable;
As noted in Table 5C, all four animals in the
Group 1 of uninfected control survived at the end of the study (40 days). All hamsters infected with C. difficile without any treatment (infected control, Group 2) had a median survival of 2 days; no animals in this group survived at the end of the study. In the vancomycin-treated group (Group 3), mean survival was 20 days, with no surviving animals on day 40. Both treatments combined with hPA-50 + hPA-41 mAb were effective in protecting animals infected in this study ( Groups 4 and 5). All (100%) hamsters treated with
136/183 the combination of humanized mAbs PA-50 + PA-41 (20 mg / kg each; Group
5) and 90% of the hamsters treated with the combination of humanized mAbs PA-50 + PA-41 (50 mg / kg each; Group 4), survived at the end of the study (40 days post-infection). All surviving hamsters had essentially normal Gl tracts at post mortem necropsy. In contrast, the average survival of animals that received a combination of the comparative antitoxin A and antitoxin B mAbs was similar for both doses of comparative mAbs; all animals died in the two groups treated with the comparative mAb combinations. Specifically, for animals that received the combination CDA-1 + CDB-1 (50 mg / kg each; Group 6), the median survival was 14 days while, for animals that received the combination CDA-1 + CDB-1 ( 20 mg / kg each; Group 7), the average survival was 11 days.
Additional evaluations in the study included measurements of body weight, macroscopic autopsy and cecal titration of C. difficile microorganisms at the end of the study. The average body weights of animals treated with vancomycin or the PA-50 / PA-41 combination decreased during the first week post-infection and were then recovered (Fig. 16B-2). On day 39, the average body weight of animals treated with the PA-50 / PA-41 combination was similar to that of healthy, uninfected animals that were housed in parallel (P> 0.05). The average body weights of animals treated with the comparative CDA1 / CDB1 antibody combination declined regularly during the study.
On day 39, the gastrointestinal tracts of the 19 surviving animals treated with the PA-50 / PA-41 combination appeared similar to those of uninfected animals; and cecal titers of C. difficile were undetectable (<1.3 logw CFU, n = 11) or low (4.15 ± 0.76 log ₁₀ CFU, n = 8). In contrast, inflamed gastrointestinal tracts were seen in some or all of the animals in the other treatment groups at the time of death. C. difficile was detected in 4 of 4 untreated animals (mean CFU = 8.96 ± 0.59 log ™, P <0.0001 with respect to PA-50 / PA-41) and 4 of 4 animals treated with vancomycin (Mean CFU = 6.01 ± 0.93 log-ίο, P <0.017 with relation
137/183 tion to PA-50 / PA-41) for which caecal analyzes were performed. Most hamsters treated with the comparative CDA1 / CDB1 antibody combination had little to no cecal content, which prevented quantitative analysis of C. difficile titrations.
For statistical analyzes in this study and in the studies above, neutralization data were adapted to a logistic equation with four parameters using the GraphPad Prism (see 4.0 GraphPad Software, San Diego, CA), t bilateral tests were used to compare means or data survival rates, respectively.
The results of the study indicate that treatment of animals infected with C. difficile with the combination of humanized mAbs PA-50 and PA-41 at both dose levels efficiently and durably protected hamsters against severe disease, initially and against subsequent disease recurrence . The duration of benefit per treatment with the combination of ‘15 humanized mAb mAb (40 days) significantly improved long-term animal survival compared to treatment with vancomycin or comparative antitoxin A and antitoxin B mAbs as controls.
As evidenced by in vivo animal studies, treatment combined with a combination of humanized 20 PA-50 / PA-41 mAbs was highly effective against C. difficile infection in the well-established Golden Syrian hamster model for ICD and therapy. A short course of treatment with PA-50 / PA-41 resulted in 95% survival at 39 days post-infection, compared to 0% survival for animals that had not received treatment, standard therapy with antibiotic 25 or comparative mAbs. At 39 days post-infection, animals treated with PA-50 / PA-41 had normal weights and no evident gastrointestinal injury. C. difficile could not be recovered from most animals, reflecting a> 7-log elimination with respect to untreated animals. A probable explanation for these findings is that neutralization of mediated toxins by mAb in the absence of antibiotics allowed a protective microbial flora to become reestablished in the animals' gastrointestinal tract.
It was reported that toxin A or toxin B alone was capable of
138/183 of causing fatal disease in the ICD model with hamsters and mAbs to both toxins are generally needed for maximum treatment efficacy. In the studies described above, PA-50 and PA-41 murine mAbs showed no benefit for survival when used individually at doses of 50 mg / kg in the hamster model, thus accentuating the need for combined treatment.
In general, in this study with hamsters, similar to the findings described above using combinations of murine mAb, it was demonstrated that combinations of humanized mAbs of the invention efficiently and long-lasting protected hamsters against mortality in the rigorous model of infection caused by C. difficile in hamsters. Without wishing to be bound by theory, these findings support a mechanism of action by which combinations of humanized mAb protected animals against disease caused by C. difficile and / or allowed animals to mount a response against infection caused by C. difficile during a time long enough to allow growth and re-population of normal intestinal flora in animals treated with humanized mAb, thus providing therapeutic protection to infected animals, efficient resolution of the disease associated with C. difficile and restoration of gastrointestinal health and survival.
Example 6
Binding of mAbs to the toxin A and toxin B regions of C. difficile
Experiments were conducted to determine the epitope regions of C. difficile toxin A and toxin B to which mAbs of the invention bind. Toxin A and toxin B produced by C. difficile are approximately 300 kDa and share considerable sequence and structure homology. Both have a C-terminal receptor-binding domain that contains repetitive clostridial oligopeptides (CROPs), a hydrophobic central domain that is believed to cause pore formation and mediate the insertion of the toxin into the endosome membrane and a proteolytic domain that cleaves the N-terminal enzyme domain, thus allowing the glycosyl transferase to enter the cytosol. Nucleic acid sequences encoding C. difficile toxins, as well as other C. difficile proteins, have been published and are also accessible in the National Center for Biotechnology Information (NCBI) database (ie, www. ncbi.nlm.nih.gov). For example, for the C. difficile strain VPI 10463, DNA sequences encoding toxin A and toxin B can be found under NCBI Accession No. x92982; furthermore, NCBI Accession No. NC_009089, region 795842-803975, provides the DNA sequence for toxin A of the complete genomic sequence of chromosome 630 of C. difficile, while NCBI Accession No. NC_009089, region 787393-794493 , provides the DNA sequence encoding toxin B from the sequence of chromosome 630 from C. difficile.
A. Mapping of the C. difficile toxin B antibody binding domain Full-length C. difficile toxin B consists of three main domains: an N-terminal enzymatic domain that processes glycosyl transferase (GT) activity (63 kDa) and a C-terminal cell receptor binding (59 kDa), which are on either end of a putative translocation domain (148 kDa) (Figs. 17A and C). Several fragments of toxin B were generated by enzymatic dividing of full length toxin B using the enzyme caspase 1 (Fig. 17C). After treatment of toxin B with caspase 1 (enzyme / toxin ratio of -1 U / üg of toxin) at 37 ° C for 96 hours, four main fragments were produced, including two C-terminal fragments (193 and 167 kDa) and two N-terminal fragments (103 and 63 kDa), as detected via SDS-PAGE (Fig. 17B). Other smaller fragments, such as 26 and 14 kDa, also appear to have been generated, but are not detectable in 3-8% Tris-Acetate gel analysis.
SDS-PAGE and Western blot analyzes were performed on toxin B that was not treated or treated with caspase 1 (Figs. 18A-C). mAb PA-41 recognized the 103 kDa and 63 kDa fragments of toxin B treated with caspase 1 (right row in Fig. 18B) thus indicating that PA-41 binds to the N-terminal enzyme domain of toxin B. N-terminal sequence analysis confirmed that PA-41 binds to the 63 kDa N-terminal enzyme domain of toxin B. It is interesting to note that a 63 kDa band in untreated toxin B (left row, Fig. 18B) was not recognized
140/183 da by PA-41, which suggests that two fragments with the same molecular weight (63 kDa) in the rows appear to be different proteins mAb PA-39 bound to the 167 kDa fragment of toxin B treated with caspase 1 (Fig 18C, right row), as well as a 63 kDa protein in the untreated toxin B preparation (Fig. 18C, left row), thus suggesting that PA-39 binds an epitope in the toxin translocation domain B. Thus, based on the results of SDS-PAGE / Western blot analyzes of C. difficile toxin B treated with caspase 1, it was observed that mAbs PA-41 and PA-39 interact differently with toxin B. While it was found that mAb PA-41 binds to an epitope in the N-terminal enzyme domain of toxin B, mAb PA-39 has been found to bind to an epitope in the toxin translocation domain (amino acids 850-1330). These findings were also confirmed by SDS-PAGE / Western blot analyzes of toxin B fragments using enterokinase digestion.
Competitive binding of antitoxin B mAbs to toxin B was also performed using Biacore. As seen in Figs. 19A-E, mAbs PA-39 and PA-41 bind to different epitopic regions of toxin B. It has been observed that murine mAbs PA-39 and PA-41 bind to an isolated site or epitope on toxin B; these mAbs were found not to bind to the C-terminal cell receptor (CRB) binding domain. For murine PA-41, the binding affinity for toxin B was 0.59 mM. In addition, the PA-41-linked toxin B site does not block the binding of comparative antitoxin B mAb CDB-1 (WO / 2006/121422; US2005 / 0287150), (Fig. 19D). These findings are in agreement with the results of Western blot analyzes. As seen in Figs. 19C and E, the comparative antitoxin B mAb CDB-1 binds to toxin B are epitopes different from those of mAbs PA-39 and PA-41.
B. Antigen-binding domain mapping of C. difficile toxin A
Full-length C. difficile toxin A has a molecular weight of 310 kDa (Fig. 20A) and contains three main domains: an N-terminal enzymatic processing domain that has glycosyl activity
141/183 transferase (GT) (-63 kDa) and a C-terminal CRB domain (-101 kDa), which are at either end of a hydrophobic domain (-144 kDa).
Several fragments of toxin A were generated by enzymatic divination of the full-length toxin using the enzyme enterokinase (EK). After treatment of toxin A with enterokinase (enzyme / toxin ratio: approximately 3 mU / Qg of toxin) at 25 ° C for 48 hours, nine main fragments were produced, including four C-terminal fragments (-223, -158-160 , -91 and -68 kDa) and three N-terminal fragments (-195, -181 and -127 kDa). Smaller fragments (-53 and -42 kDa) were also observed (Figs. 20 B and C).
SDS-PAGE and Western blot analyzes were performed on toxin A that was not treated or treated with enterokinase (Figs. 21A-C). Full-length toxin A and its fragments having molecular weights of -223, -158-160, -91 and -68 kDa were recognized by mAb PA-50 (Fig. 21B); N-terminal sequencing confirmed that the 68 kDa fragment contains part of the C-terminal receptor binding domain (CRB). The binding pattern of mAb PA-50 suggests that mAb binds to C-terminal fragments of toxin A. Taken together, the results indicate that mAb PA-50 binds to C-terminal binding epitopes on toxin A. mAb PA-39 bound to C-terminal fragments (-223 and -158-160 kDa), as well as a -181 kDa N-terminal fragment (Fig. 21C), thus indicating that PA-39 mAb binds to an epitope in a region outside the toxin A receptor binding domain. Multiple binding sites (at least two binding sites) were also identified in an interaction study of mAb PA-50 and toxin A using a Biacore assay (Fig 22A-1). In comparison studies using Biacore analysis, immobilized murine PA-50 specifically bound to toxin A with an affinity of 0.16 nM. It was also found that, after being captured on the Sensor Chip by the murine mAb PA-50, toxin A was able to bind additionally to the PA-50 and, subsequently, comparative antitoxin A mAb CDA-1 (documents WO / 2006 / 121422; US2005 / 0287150), (Fig. 22A-2). Additionally, toxin A captured by the comparative antitoxin A mAb CDA-1 on the Biacore chip is
142/183 additionally bound to mAbs CDA-1 and PA-50, indicating that the comparative mAb CDA-1 binds to multiple repeats in toxin A, which are different from the binding epitopes of mAb PA-50 to toxin A (Fig 22B). Thus, as determined from these results, the mAb PA-50 mAb epitope is present in multiple copies on toxin A and does not overlap the CDA-1 epitope. further, mAb PA-39 bound to epitope (s) in toxin A different from the toxin A epitope (s) bound by comparative CDA-1 mAb (Fig. 22C). The PA-39 and PA-50 mAbs were found to bind to different epitopes on toxin A (Fig. 22D). Western blot analysis showed that the comparative mAbs PA-39 and CDA-1 have different binding patterns to toxin A treated with EK, thus indicating different binding domains and different epitopes in toxin A (Fig. 22E). Western blot analysis showed that the comparative mAbs PA-50 and CDA-1 bind to the same toxin A domain treated with EK (Fig. 22F), but to different epitopes (Fig. 22B).
As described in A and B of this Example, the binding sites for the murine mAbs PA-50 and PA-41 were located in specific regions of the toxins by limited proteolysis of the toxins, followed by Western blotting. The murine mAb PA-50 recognized full-length toxin A and several products from the enterokinase divage, including a large 223 kDa fragment and carboxy-terminal fragments of 68, 91 and 160 kDa in size (Fig. 22F). N-terminal sequencing confirmed that the 68 kDa fragment corresponds to the terminal carboxy domain of toxin A. The same fragments were recognized by the comparative mAb CDA-1. The murine mAb PA-41 bound to the full-length toxin B, as well as to the 63 and 103 kDa amino-terminal fragments generated by digestion with caspase-1 (Fig. 18B), while the mAb CDB-1 The comparative study recognized a distinct set of products from the caspase-1 divage. N-terminal sequencing confirmed that the 63 kDa fragment corresponds to the toxin B amino terminal domain. Collectively, the data indicate that mPA-50 binds to multiple sites within the toxin A receptor binding domain and mPA-41 binds to an isolated site within the enzyme domain of toxin B.
143/183
Example 7 mAbs antitoxin A and C. difficile toxin B - Mechanism of action studies
A. In vitro cell-based tests used for studies of mechanism of action
To assess the mechanism of action of the antitoxin mAbs, in vitro assays were performed using different concentrations of toxin A or toxin B. These assays used CHO-K1 or T-84 cells, as described in Example 3 above.
Briefly, the CHO-K1 assay was used to assess the neutralization potency of mAbs antitoxin A and antitoxin B (PA-39 and PA-41). CHO-K1 cells were seeded (2,000 cells / well) in 96-well slides. The cells were allowed to set for 4 hours before treatment. Different concentrations (60, 30, 15 or 6 ng / mL) of C. difficile toxin (strain VPI 10463) were incubated with serially diluted mAbs, mixed in 96-well round bottom slides for 1 hour at 37 ° C and at The mixture was then added to the cell culture slides. After incubation for 72 hours, 20 µl / well of CelITiter-Blue was added; the mixture was incubated for an additional 4 hours; and percent cell survival compared to controls was measured.
The T-84 cytotoxicity assay was also used to assess the neutralizing potency of antitoxin mAbs A. T-84 cells (human colon carcinoma cell line) were seeded (15,000 cells / well) in 96-well slides. The cells were allowed to set for 4 hours before treatment. Different concentrations (240, 120, 60 or 30 ng / mL) of C. difficile toxin (strain VPI 10463) were incubated with serially diluted mAbs, mixed in 96-well round bottom slides for 1 hour at 37 ° C and at The mixture was then added to the cell culture slides. After incubation for 72 hours, 20 µl / well of CelITiter-Blue was added; the mixture was incubated for an additional 4 hours; and percent cell survival compared to controls was measured.
B. ELISA that shows that antitoxin A mAbs prevent internalization of all
144/183 xin A in cells
In an experiment designed to further evaluate the mechanism of action of C. difficile mAb antitoxin, each test antibody (PA-39, PA-50, comparative antitoxin A mAb CDA-1 and a goat antitoxin A polyclonal antibody control) it was mixed and incubated for 1 hour at 100x its EC ₉₀ value with a CC ₉₀ concentration of toxin A for Vero cells, in order to ensure complete neutralization in a highly cytotoxic toxin A concentration. The mixture was then incubated with Vero cells at 37 ° C for 15 minutes. The cells were then washed with PBS, fixed and permeabilized. An anti-toxin A antibody, labeled with horseradish peroxidase (HRP) (PA-38), which does not compete for binding with the tested antibodies, was used to hybridize internalized toxin A and detected using chemiluminescence (Fig. 31G). In this assay, only toxin A that has bound and been internalized in a cell will be detected by the probe, thus providing a chemiluminescent signal based on a chemiluminescent reaction with HRP. Chemiluminescent detection uses an enzyme to catalyze a reaction (that is, the catalyzed oxidation of luminol by peroxide) between the HRP enzyme and its substrate in the presence of peroxide, which results in the generation of visible light. Oxidized luminol emits light as it declines to its base state. Once the substrate is catalyzed by HRP, the light signal is quantified by a luminometer (Analyst GT).
C. Results of neutralization activity and MQA studies mAbs antitoxin A
In the cell cytotoxicity assay used to assess the neutralizing activity and mechanism of action for anti-toxin A antibodies, toxin A was added in increasing concentrations to the cells, as described above in Section A of this Example. The results of these experiments, in which neutralization of toxin A by antitoxin A mAbs PA-39, PA-50 and comparative mAb CDA-1 was evaluated, are shown in Figs. 31B-D and in Table A below.
145/183
Table A. Results of potency experiment against toxin A and maximum percentage inhibition
SM Ββί iM OWSffli: PA-39 60 0.340 6930 0.080 8615 0.003 96 PA-50 6240 0.0020.91 97105120 0.54 10060 0.27 11430 0.10 118 comparative CDA-1 mAb 2409.0 52120 6.6 7460 5.1 10330 2.0 110
*: EC50 was calculated as a maximum percentage inhibition of 50% in cases where the curves do not reach 100% of the control.
As observed from the data presented in Table
A, the in vitro activity of mAb PA-39 in the potency test against toxin shows changes in EC50 and in the maximum percentage inhibition the more toxin A is added to the culture, indicating a mixed competitive inhibition mechanism for PA-39. ELISA detection of toxin A after 10-fold protection a 100-fold excess of PA-39 confirmed that inhibition of the toxin by PA-39 occurs by preventing internalization of the toxin and a cyto-cellular effect of the toxin. The in vitro activity of mAb PA-50 in the potency test against toxin shows a change in EC _{50 the} more toxin A is added to the culture, indicating a competitive inhibition mechanism for PA-50. 15 ELISA detection of toxin A after protection by a 100-fold excess of PA-50
146/183 confirmed that inhibition of the toxin by PA-50 occurs preventing internalization of the toxin.
antitoxin B mAbs
In the cell cytotoxicity assay used to assess the neutralizing potency and mechanism of action for anti-toxin B antibodies, toxin B was added in increasing concentrations to the cells, as described in Section A of this Example. The results of the potency experiments, in which neutralization of toxin B by antitoxin B mAbs PA-41 and comparative mAb CDB-1 was evaluated, are shown in Figs. 31E and F and in Table B below. As observed from the data presented in the Table, the in vitro activity of PA-41 in the potency test against toxin shows changes in EC ₅₀ and in the maximum percentage inhibition the more toxin B is added in the culture, indicating a mixed competitive inhibition mechanism for PA-41.
Table B. Results of the potency experiment against toxin B and inhibition
*: EC50 was calculated as a maximum percentage inhibition of 50% in cases where the curves do not reach 100% of the control.
Based on the tests described above in this Example, an inhibitor that has the ability to completely neutralize concentrations
147/183 increasing toxin A or toxin B simply by adding higher concentrations of inhibitor would show a change in EC50 the more antibody binds and neutralizes the highest concentrations of toxin and thus would be considered as a competitive inhibitor. An inhibitor that is unable to overcome the toxic effects of increasing concentrations of toxin would show a reduced maximum percentage effect at higher concentrations of inhibitor, but would not show a change in EC50 and would therefore be considered a non-competitive inhibitor. In addition, an inhibitor that exhibits a change in EC50 and a reduced maximum percentage effect as a result of increasing concentrations of inhibitor in higher concentrations of toxin would be considered to be a competitive mixed inhibitor. To some extent, the evaluation of the mechanism of action using cell cytotoxicity assays should be performed considering the error involved in the repeatability of the assay and the base cytotoxicity observed in control wells without inhibitor, which affect the maximum percentage inhibition plateau . Consequently, a slight shift to the right in the EC50 values can be observed as the toxin concentrations are increased due to these effects.
According to the precedent, for neutralization and MOA of toxin A, mAb PA-39 is considered a mixed competitive inhibitor due to the deviation in EC ₅₀ and reduced plateau observed for cytotoxicity curves for PA-39 (Fig. 31B) , as well as the reduced maximum percentage effect calculated in Table A. These data are supported by the ELISA results (Fig. 31H), which show a degree of cytotoxic effect in high concentrations of PA-39, thus indicating that at least part of MOA for PA-39 occurs intracellularly. It is observed that mAb PA-50 is a competitive inhibitor, as evidenced by the shift to the right in the EC ₅₀ values observed in the cytotoxicity assay curves (Fig. 31C) and by the data presented in Table A, which show minimal change in maximum percentage inhibition. These data are supported by the ELISA results (Fig. 31H), which show complete inhibition of toxin A binding and internalization in high concentrations of PA-50.
148/183
As seen in Fig. 31 D, the comparative CDA-1 mAb shows minimal deviation from the EC50, but considerable decrease in the maximum percentage effect as the toxin increases. When the results shown in Fig. 31D are considered with the data presented in Table A, the comparative CDA-1 mAb demonstrates a non-competitive mechanism of action, since all its activity is observed outside the cell. Steroid impediment of toxin binding and cellular internalization are probably responsible for providing the data plotted in Fig. 31 D, thus sustaining a non-competitive MOA for the comparative CDA-1 mAb.
According to the precedent for neutralization of toxin B and MOA, it is considered that mAb PA-41 exhibits a mixed competitive action mechanism due to the deviation to the right of the EC50 values and the reduced maximum percentage effect observed in Fig. 31E and the data presented in Table B.
The results observed for mAb PA-41 are in contrast to those seen for comparative CDB-1 mAb, which exhibits a reduced maximum percentage effect, but a lesser degree of EC50 deviation. In this case, the mechanism of action for comparative mAb activity against toxin B is less evident, particularly in view of the error considerations mentioned above.
Example 8
Testing the invention's mAbs against a panel of isolates or strains of
C. difficile, including isolates or hyper-virulent strains
To assess the ability of C. difficile mAbs antitoxin A and antitoxin B of the invention to neutralize toxins from a wide range of relevant C. difficile isolates, the mAbs neutralizing activity was tested against a collection of twenty clinical isolates or strains of C. difficile toxigenic, including hypervirulent BI / NAP1 / 027 isolates. Since C. difficile exhibits considerable inter-strain heterogeneity in the genes encoding toxins A and B, these studies were conducted to examine the extent of toxin neutralization by the described mAbs and, in particular,
149/183 mAbs PA-50 and PA-41.
A panel of clinical toxigenic isolates of C. difficile (Table
6) was selected for geographic and genetic diversity based on the type of toxin, ribotype and analyzes with restriction endonuclease from an international collection of C. difficile isolates or strains maintained at TechLab (Blacksburg, VA).
As classified in Table 6, C. difficile strains include 3 reference strains (VPI 10463 (ATCC 43255), 630 (ATCC BAA 1382) and 545 (ATCC 43596), six strains derived from hospital BI / NAP1 / 027 10 ( CCL678, HMC553, Pitt45, CD196, 5, 7.1), two strains toxin A- / toxin B + (tcdA-tcdB +) (F1470, 8864), three isolates from outpatients (MH5, CCL13820 and CCL14402) and others isolates frequent clinical findings (Pitt2, CCL14137, UVA17, UVA30 / TL42, Pitt102, Pitt7). Additionally, isolates 13 (CCL13820) and 19 (Pitt 102), which are classified as an outpatient isolate of 15 and a frequent clinical isolate (other than Ribotype 027), respectively, in Table 6 are also toxA- / toxB + strains. Culture supernatants containing these C. difficile toxins were produced at TechLab, sterilized in a filter and stored at 4 ° C. The presence of the toxins in the culture supernatants was confirmed using the C. difficile To20 xin / Antitoxin kit (TechLab) and the cytotoxicity assay.
The cytotoxic activity of each culture supernatant containing toxin for CHO-K1 cells (used to determine toxin B activity in culture supernatants) and T-84 cells (used to determine toxin A activity in culture supernatants) was evaluated treating cells with titrated culture supernatants.
150/183
Table 6. Isolates / strains of C. difficile used to generate supernatants
Location USA Switzerland Louvain, Belgium Virginia, USA Pennsylvania, USA Pennsylvania, USA Paris, France Quebec, Canada Quebec, Canada Louvain, BelgiumBimingham, England Virginia, USA Virginia, USA Virginia, USA Year m σ> l CM CO σ>- Unknown the oCM CO o CM 2001-2002 00 CO σ>T— o the CM the oCM o o> σ>CO 00 σ> r— 00 o CM 00 o CM CO O o cm OER type Unknown Unknown Unknown QC T—LL O> o Unknown IX. O tn Type of toxin O Unknown i____________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________ Unknown >X Unknown > = Ribotype CO o o Unknown Unknown CM O X OCD CO d τ-Ο O χ-Ο cxi o Category Reference strains A + B +-Ribotype 027 (hospital isolates) Strains tc- dA-tcdB + Outpatient isolates Strain VPI 10463ATCC 43255 630 ATCC BAA-1382 545 ATCC 43596 COCD-1OO HMC553 Pitt 45 CD 196 to V " F14708864CCUG 20309 MH5 CCL 13820 CCL 14402 oNCM COLO <o r- 00 σ> O CN • V Color- T ^-
151/183
Table 6. Continuation
<r < <Z)The tflj LU ”5 Ξ) z> UJ UJ O at LU UJ LU at at N ç Ass CO CO ç ç<QC <co <co at > ç ç ç > > O o ω E>O) L · - ώ-1 c φ >> c Φ c Φ0- 0.CM CM CMr>O O O OO € 0 O O O O O CM O CM CM CM CM O CCS CD V ▼ “O CM π O O OOO O O OCMCM CM CM CM the OER T> —3 CD > - CF BK Q. frog O O O O ç TO TJ Ό TSX O O O O O <D at a> <D ·· - * r.ç. x: —__Φ ç ç ç. ç> O O O O O O O O O O 0) <0 (0 <0 CL at <D 0) 0) □ Q Q Q O Q. ▼ -CM 00 O O O O V O O O O O O CE (Λ at.8 Z5O, b • as Z- * S (N•ç ç O Oç at a> OO) Φω o c Φ D cr Q.atÇ □ Φ OOπ ΓΓ 2 -Q the </> 2 M-go CM (Ό3 CMat CMT " t; OO. OK T ~ < O TO 0. —1 O > D < Pitt CL O5 O IO CDCO σ> O z T " T— CM
152/183
To test the mAbs neutralization activities of the invention, culture supernatants containing toxin were used at the maximum dilution that resulted in a loss of> 95% in cell viability. Supernatants with toxin were premixed with various concentrations of mAbs for 1h and then added to the cells for incubation at 37 ° C for 72h. Cell viability was measured using Cell-Titer Blue (Promega). The percentage survival of the treated wells was compared with that of untreated control wells and plotted to calculate the in vitro neutralization activities (EC ₅ o) of the mAbs. In a first series of experiments, Fig. 23A shows the activity of mAb PA-41 in neutralizing toxin-containing supernatants using CHO-K1 cells. PA-41 potently neutralized (EC _{50 range} from 1, T ¹¹ M to 6.5 ^'10 M) supernatants of all toxigenic strains of C. difficile, including all hyper-virulent strains, with the exception of three toxin strains A- / B + toxin. It has been reported that there are significant sequence differences in the enzymatic domains of toxin A- / toxin B + from conventional strains of C. difficile. Due to the fact that PA-41 binds to the enzyme domain of toxin B, the sequence diversity in this domain may explain the less efficient neutralization activity of PA-41 against toxin B of the two toxin A- / toxin B + strains.
Experiments were also conducted to evaluate the activity of the comparative CDB-1 mPAbs hPA-41 and human antitoxin B (WO / 2006/121422; US2005 / 0287150), against hypervirulent C. diffiicle strains in the CHO-K1 cell line . In these studies, it was observed that hPA-41 showed significant neutralization activity against the supernatants of all 6 strains BI / NAP1 / 027, while the comparative CDB-1 mAb showed minimal activity (Fig. 23B). Also in these studies, it was observed that the neutralizing activity of mPA hPA-41 was> 1,000 times greater than that of comparative mAb CDB-1 in neutralizing the toxicity of the BI / NAP1 / 027 strains. The neutralization activity of the hPA-41 and CDB-1 mAbs compared to the 2 reference strains (VPI 10463 and ATCC 43596) and 6 strains BI / 027/027 (CCL678, HMC553, Pitt 45, CD196,
153/183
Montreal 5.1 and Montreal 7.1) is illustrated in Fig 23B. In these studies, hPA-41 was found to be inactive against three isolates of Ribotype 017 (Table 6) which are toxin A- / B +, while mAb hPA-41 antitoxin B exhibited significantly greater neutralization activity than mAb comparative against other strains on the panel.
The activity of mAb PA-50 in neutralizing supernatants from C. difficile cultures containing toxin A using T-84 cells ranged from 2.6 ^'12 M to 7.7' ¹¹ M, as shown in Fig. 24A. PA-50 completely neutralized supernatants from all available strains that produce toxin A, including hyper-virulent strains. PA-50 does not neutralize the four strains toxin A- / toxin B + (F1470, 8864, CCL 13820, CCL 14402), since these strains do not produce any toxin A. hPA-50 was also significantly more efficient in neutralizing the activity of remaining strains on the panel. In other comparative studies, hPA-50 neutralizing activity against all 6 C. difficile BI / NAP1 / 027 strains that produce toxin A was found to be> 100 times greater than that of the comparative CDA-1 mAb (documents WO / 2006/121422; US2005 / 0287150), (Fig. 24B). hPA-50 also showed greater neutralization activity than the comparative CDA-1 mAb against reference strains VPI 10463 and 545 of C. difficile that produce toxin A. Similarly, mAb PA-39 neutralized toxin A in C culture supernatants. difficile with EC ₅ values ranging from 7.7 ^'12 M to 4.8' ⁸ M, as shown in (Fig. 25A). As noted for PA-50 mAb, the four toxin A- / toxin B + strains were not neutralized by PA-39. In addition, results from comparative studies demonstrated that the neutralizing activity of mAb PA-39 against all 6 strains BI / NAP1 / 027 was> 100 times greater than that of comparative human antitoxin A mAb CDA-1; PA-39 also showed significantly more neutralization activity against the remaining strains on the panel (Fig. 25B). It should be noted that a toxin-producing strain, CCL 14402, does not reduce the viability of T-84 cells sufficiently enough to allow an accurate measurement of mAb neutralization activity in the assay.
154/183
In these studies with the CHO-K1 cell line, hPA-41 showed high levels of neutralizing activity against the supernatants of all 6 strains BI / NAP1 / 027, while the comparative mAb CDB-1 showed minimal activity. It was observed that humanized PA-41 has a neutralization activity> 1,000 times greater than that of the comparative mAb CDB-1 in neutralizing the C. difficile hypervirulent BI / NAP1 / 027 strains. The neutralization activities of hPA-41 and CDB-1 in these studies against the 2 reference strains (VPI 10463 and ATCC 43596) and 6 strains BI / 027/027 (CCL678, HMC553, Pitt 45, CD196, Montreal 5.1 and Montreal 7.1 ) are illustrated in Fig 23B. Similarly, hPA-41 showed significantly greater neutralization activity in these studies compared to the mAb CDB-1 compared to the other strains in the panel, with the exception of three isolates of Ribotype 017, which are toxin A- / B +. Similar experiments were carried out to evaluate the neutralizing activity of hPA-39 and that of comparative human anti-toxin A mAb CDA-1 on T-84 cells. The results showed that neutralization of all 6 strains BI / NAP1 / 027 by hPA-39 was> 100 times greater than that of the comparative mAb CDA-1 (Fig 25B). Humanized PA-39 also showed significantly greater neutralization activity in the studies than the comparative CDA-1 mAb against the remaining strains on the panel. Thus, the hPA-41 and hPA-39 mAbs showed high levels of anti-virulent anti-strain strain of C. difficile against all tested strains. This indicates that the epitopes recognized by these humanized mAbs are highly conserved through different strains.
Similar to Table 6, Table 7 presents the results of the in vitro C. difficile toxin neutralization experiments described above, showing the panel of C. difficile toxigenic strains isolated from North America and Europe and the resulting EC ₅₀ values generated by the humanized antitoxin mAbs and comparative mAbs CDA-1 and CDB-1. The panel includes ribotypes 001, 002, 003, 012, 014, 017, 027 and 078 in an appropriate proportion to the rates observed clinically (94, 95), with the exception of the 017 tcdA'tcdB ⁺ ribotype strains, which are over-represented on the panel. On
155/183 swimmers of tcdA'tcdB ⁺ strains were used as tools to identify cells that were resistant to death by supernatants containing toxin B alone and thus would be suitable for examination of toxin-mediated cytotoxicity. VPI 10463 was included in the panel and allowed the comparison of results obtained with purified and unpurified toxins.
In these studies, humanized PA-50 mAb neutralized toxin A in a strain-independent manner. The median EC ₅ value was 32 pM (range: 20 to 127 pM, Table 7) and gradual dose-response curves were observed with Hill's declines that were typically greater than two (Fig. 25C). PA-50 was more active than CDA1 against each of the test isolates. The greatest difference in potency was observed for the hypervirulent strains 027, for which PA-50 was approximately 1,000 times more potent than CDA1 (P = 0.0002) and for a ribotype 078 strain included in the panel.
Humanized PA-41 mAb potently inhibited each of the tcdA ⁺ tcdB ⁺ strains with a median EC ₅ value of 23 pM (range: 7.7 to 129 pM, Table 7) and essentially complete neutralization was observed in higher concentrations (Fig . 25D). PA-41 was generally more efficient than CDB1 against tcdA ⁺ tcdB ⁺ strains and was approximately 500 times more potent against hypervirulent strains 027 (P = 0.003). CDB1, but not PA-41, was efficient in neutralizing toxin B from strains of ribotype 017 tcdA'tcdB *. Finally, PA-41 and PA-50 exhibited similar activities against crude and purified forms of toxin from the reference strain VPI 10463 (Table 7 and Figs. 25C and 25D).
Table 7. Neutralization of toxins from different strains of C. difficile in vitro
EC ₅ o, pM
Ribotype Cepa mAbs antitoxin A mAbs antitoxin B
PA-50 CDA1 PA-41 CDB1
1 '! I twfô39. r 1 '- ~ r' 611 9.7 129 001MH5 127 384 18 73 B 27 947 q q9002UVA17 26 825 129 671
156/183
Ribotype EC50, pM MAbs antitoxin A strain PA-50 CDA1 PA-41 CDB1 003 VPI 10463 20 1271 7.7 ,,, 136 012 545 38 4552 15 153
014 UVA30 / TL42 51 625 21 324 KMM Ι ··· Ι · βΜ ·· Ι ··· ft 017 F1470 N / AN / A> 10 ⁵ 46 027 CCL678 29 58,950 77 > 10 ⁵ 027 ΙγΙΐΙ i 'thx. ^J 'hi - * 1 ¹ CCL14402 ND ND 19I Τ.Ό / o ii ¹ Π '* r 027 CD196 61 132,600 16 9,812
027 Montreal 5 29 87,090 36 25,810
0271 31• νιΓ ·· i. _ < 109'400 Swl <8-00. 027 Pitt 45 43 108,100 29 26,510 078 - ~ ⁷ vW 07 '> 1O’M: υJ r -50 ' ^{L 1} ^ ~ 8 4Ϊ 5 1
As shown in this Example, humanized mAbs PA-50 and PA-41 showed a high level of neutralizing activity against C. difficile toxins A and B, respectively, from genetically diverse strains representative of the current epidemic IDC. The range of activity of these mAbs is notable in light of the genotypic and phenotypic variation within the toxins. In particular, PA-50 and PA-41 neutralized toxins produced by the 027 hyper-virulent strains, resistant to antibiotics with picomolar activity, while comparative mAbs were observed to have nanomolar activity. This result may reflect the reduced binding of CDA-1 to toxin A of strains 027, as previously reported (90). Toxin B of strains 027 exhibits marked sequence divergence from other strains of C. difficile. Sequence differences are concentrated within the carboxy-terminal receptor binding domain and are associated with increased cytotoxicity in vitro. However, such a divergence of sequence does not affect
157/183 PA-41 neutralizing activity, which binds to an epitope within the amino-terminal domain of toxin B. PA-50 and PA-41 neutralized all six strains 027 on the panel with picomolar potencies, including the strain CD196, which predates the recent rise in the prevalence of 027. In general, the findings indicate that the epitopes for PA-50 and PA-41 are largely conserved through the 027 strain.
ICD is typically caused by strains of C. difficile that produce toxins A and B. However, tcdA tcdB * strains have also been linked to the disease. Clinically relevant tcdA'tcdB * strains are predominantly of ribotype 017. Ribotype 017 strains have been reported to exhibit reduced pathogenicity in hamsters and encode an atypical tcdB whose amino-terminal region brings 70-80% sequence identity with tPIB of IPV 10463 and lethal toxin (tcsL) of C. sordellii. Phenotypically, tcdB of ribotype 017 has hybrid characteristics and exhibits the receptor binding properties and glycosylation specificities of typical tcdB and tcsL toxins, respectively. The atypical amino-terminal region of tcdB 017 provides a probable explanation why this toxin was not neutralized by PA-41 in this study. Although 017 strains may be regionally prevalent and cause local outbreaks of ICD, in general, it has been determined that they comprise <2% of the strains found in recent international phase 3 clinical studies of investigative therapies for treating ICD (94, 95).
Example 9
Generation of chimeric mAbs
Chimeric monoclonal antibodies comprising the variable region of the mouse parental mAb and the constant region of human IgG1 have been produced and characterized. Chimeric mAbs were generated to ensure that murine variable regions that have the correct antitoxin activity and binding specificity were cloned and that construction of the murine variable regions with the human constant region does not significantly alter the binding and neutralization properties of each cloned mAb. Chimeric mAbs typically exhibit the same binding activity as mouse parental mAbs.
158/183 mAbs PA-38, PA-39, PA-41 and PA-50 all contain kappa light chains. To generate the chimeric mAbs, the nucleic acid sequences encoding the variable regions of the heavy and light chains were inserted into suitable expression vectors such as, but not limited to, pCON Gamal and pCON kappa, respectively (Lonza Biologies, Berkshire, UK ). Suitable plasmids encode the human kappa light chain constant region or the human IgG1 heavy chain constant region. For chimeric mAb production, the heavy chain variable region of each mAb was cloned into plasmid pCON gamai. The complete heavy chain gene was subcloned into the plasmid containing the light chain gene to create a single plasmid encoding the heavy and light chain genes. 293F cells were transiently transfected with this expression vector using Effectene (Qiagen, Valencia, CA) according to the protocol suggested by the manufacturer. Cell supernatant containing secreted chimeric mAb was collected seven days after transfection and purified using Protein A chromatography. The potencies and activities of the chimeric mAb (s) were compared with those of murine mAbs in cytotoxicity and hemagglutination assays.
According to the above procedure, chimeric mAbs (cPA-39 and cPA-41) were generated based on the mouse parental mAbs PA-39 and PA-41. The concentrations of these chimeric mAbs in crude cell supernatants ranged from approximately 2-11 pg / mL. In particular, crude supernatant from a culture of transfected 293F cells producing cPA-39 contained 10.6 pg / ml of the chimeric mAb, while crude supernatants from various cultures of transfected 293F cells producing cPA-41 contained 9.6- 10.9 pg / ml of the chimeric mAb.
Chimeric mAbs were compared with their respective mouse parental mAbs with respect to their ability to neutralize C. difficile toxins in vitro by conducting cytotoxicity assays (cPA-39: CHO-K1 cells, cPA-41: CHO-K1 and cPA-50 cells : T-84 cells), as previously described (Example 3). All chimé mAbs were found to be
159/183 rich were equally efficient when compared to their parental murine mAbs, as shown in Fig. 26 (PA-41), Fig. 27 (PA-39) and Fig. 28 (PA-50). These results demonstrate the success of chimerization and the production of functional chimeric mAbs that have toxin neutralization potencies equivalent to those of the mouse parental mAbs.
Example 10
Humanization of murine mAb (s) and testing of the humanized mAbs of the invention for the in vitro toxin neutralization potency Humanized mAbs were generated by methods known in the art. Examples and descriptions of various humanized mAbs include, for example, Zenapax (65.66) Synagis (67-69), Herceptin (70-72), Milotarg (73.74), Xolair (75-77), Raptiva (78 -80), Avastina (81.82) and Tysabri (83). Humanized monoclonal antibodies that are effective in minimizing the immunogenicity of the agent can be generated, so that mAb activity in humans is not adversely affected. (84-87). Preferably, humanized mAbs demonstrate toxin neutralizing activity that is within twice the mouse parental mAbs. Also, humanized mAbs demonstrate, in an excellent way, potent efficacy in the model of infection caused by C. difficile in hamsters.
Established methods of grafting the complementarity determination region (CDR) were used to generate humanized forms of the murine antitoxin A and / or antitoxin B mAbs, as described here. The humanized mAb (s) were compared with the mouse parental mAb (s) in relation to the toxin neutralization activity in vitro and in vivo. According to the invention, the humanized mAb (s) may (s) retain the antitoxin activity of the murine parental mAb (s) and may be suitable for repeated dosing in humans.
A. Molecular cloning of murine mAbs heavy and light chain genes
Established methods were used for the cloning of antibody genes. (88) Briefly, total RNA was purified from
160/183
1x10 ⁷ hybridoma cells using TRIzol reagent (Invitrogen) according to the protocol suggested by the manufacturer. 5 µg of total RNA was reverse transcribed using SuperScript II Reverse Transcriptase (Invitrogen) using an oligo-dT primer. The resulting cDNA was treated with RNAse H to remove the RNA template and was then purified using a QIAquick PCR purification kit (Qiagen) to remove the free nucleotides and primers. Then, a guanidine nucleotide tail was added to the 3 'end of the cDNA using the terminal enzyme transferase (NEB) in the presence of dGTP according to the protocol suggested by the manufacturer. The resulting tailed cDNA was then individualized for PCR using a primer that hybridized to the constant region of the heavy or light chain and a universal primer that hybridized to the guanosine tail on the cDNA. For heavy and light chains, the universal primer 5TATATCTA GAATTCCCCCCCCCCCCCCCCC3 'SEQ ID NO: 11 was used. To amplify the light chain, the primer 5TATAGAGCTCAAGCTTGGATGGTGGGAA GATGGATACAGTTGGTGC3 '(SEQ ID NO: 12) was used, while the heavy chain was amplified using the primer 5'TATAGAGCTCAAGC TTCCAGTGGATAGAC (CAT) GATGTGT ID NO: 13), where the sequences in parentheses indicate base degenerations. The resulting PCR amplified DNA was purified using a QIAquick PCR purification kit (Qiagen) and sequenced. PCR reactions were performed and sequenced in triplicate to ensure that no errors were introduced during the amplification of approximately 500 base pair DNA fragments.
B. Humanization of mAb variable regions
To produce the humanized mAbs sequences, structural amino acid residues important to the CDR structure were first identified. In parallel, human VH and VL sequences that have high homology to murine VH and VL, respectively, were selected from known human immunoglobulin sequences. Murine mAb CDR sequences, along with any structural amino acid residues important for maintaining the structure of CDRs,
161/183 if necessary, were grafted into the selected human structural sequences. In addition, human structural amino acid residues found to be atypical in the corresponding V region subgroup have been replaced by typical residues in an effort to reduce the agent's potential immunogenicity to the resulting humanized mAb. These human VH and VL regions were cloned into expression vectors such as, but not limited to, pCON Gamal and pCON kappa (Lonza Biologies, Berkshire, UK), respectively. These vectors encode the constant region (s) of the human immunoglobulin heavy and light chain genes. 293F cells were transiently transfected with these expression vectors using the Effectene system (Qiagen, Valencia, CA). Cell supernatants containing secreted humanized mAb were collected seven days after transfection and purified using Protein A chromatography. Generation of cloned CHO cells. that express humanized mAbs
The generation of CHO cells / stable cell lines for the production of sufficient amounts of mAbs to test cell assays in vitro and in the C. difficile-associated diarrhea (CDAD) model in Golden Syrian hamsters. As an example, CHO K1 SV cells from Lonza Biologies (Berkshire, UK) can be used by means of selection with glutamine synthetase and the amplification system (GS) to generate stably transfected CHO cells. Lonza's GS system typically provides high production CHO cell lines that can produce measurable amounts of humanized mAbs.
CHO K1 SV cells were expanded in CHO CD cell culture medium (Invitrogen) supplemented with 1X glutamine (Invitrogen) and 1X H / T Supplement (Invitrogen). 1 x 10 ⁷ viable cells were subjected to electroporation at 290 V, infinite resistance and 960 uF with 40 pg of linearized plasmid DNA resuspended in 100 pL of sterile TE buffer. The cells were transfected in a T-150 flask containing 50 ml of complete CD medium for CHO and incubated for approximately 48 hours at 37 ° C and 8.0% CO ₂ . The cells were centrifuged and resuspended in a den
162/183 final sity of 3.3 x 10 ⁵ cells / mL in GS selection medium (CD CHO + 1X GS Supplement (JRH Biosciences) + 1X H / T Supplement) containing MSX (Sigma) at 100 μΜ, placed at 5000 viable cells / well on 96 well slides (Corning) and incubated for approximately 3-4 weeks until primary cell colonies (clones of transfected cells) begin to appear. Approximately 300 cell colonies (clones) were collected to produce recombinant mAb by carefully removing 20 μΙ_ of supernatant and performing an ELISA assay in a 96-well format. Briefly, 96-well slides were coated with a capture antibody (goat anti-human antibody) and then supernatants from the cloned CHO transfectants (diluted 1: 800) were added to allow binding to the capture antibody bound to the wells of the blade. After washing, a secondary antibody (goat anti-human antibody conjugated to alkaline phosphatase) was added to the slide and allowed to bind to the human antibody in the sample before being washed to remove the non-specific binding. The slide was then analyzed for alkaline phosphatase activity using a 1-Step PNPP kit (Thermo, Rockford, IL) to identify the clones that produce the highest amount of secreted antibody. Clones that produce high amounts of mAb were expanded in CHO CD cell culture medium supplemented with 1X glutamine and 1X H / T Supplement. Cell supernatants containing secreted humanized mAb were collected and purified using Protein A. The clones that exhibit the best production were subcloned by means of limiting dilution and scaled to produce gram amounts of humanized recombinant monoclonal antibody.
D, humanized mAbs hPA-39, hPA-41 and hPA-50
The molecularly cloned humanized mAbs were isolated as described above and characterized (see Section E below). The constant region (CL) of light chain (L) of each of the humanized antibodies is of the kappa class (k); the heavy chain (H) constant region (CH) of each of the humanized antibodies is of the lgG1 isotype. It was found that humanized mAbs containing unique variable regions (V) bind and
163/183 neutralize the activity of toxin A or toxin B of C. difficile. The V regions of the L and H chains of humanized mAbs can form a part of a complete immunoglobulin (Ig) or antibody molecule composed of two H chain polypeptides and two L chain polypeptides, typically linked by disulfide bond or they can be distinct antibody portions or fragments, in particular antibody portions or fragments that bind toxin A and / or toxin B and / or neutralize toxin activity. Non-limiting examples of suitable V region-containing immunoglobulin fragments or portions include F (ab), F (ab ') or F (ab') ₂ fragments.
Humanized anti-toxin A and C. difficile toxin B mAbs were produced according to the procedures described above. The humanization process provided several humanized C. difficile antitoxin A mAbs (hmAbs) that bind to toxin A and neutralize the activity of toxin A on susceptible cells. Examples of such hmAbs include humanized C. difficile antitoxin A mAb comprising a H chain polypeptide sequence comprising a VH region of SEQ ID NO: 1 (Fig. 32A) and a human IgG1 C region and a chain polypeptide sequence L comprising a VL region of SEQ ID NO: 3 (Fig. 33A) and a human κ C region; C. difficile antitoxin A hmAb comprising a H chain polypeptide sequence comprising a VH region of SEQ ID NO: 2 (Fig. 32B) and a human IgG1 C region and a L chain polypeptide sequence comprising a VL region SEQ ID NO: 3 (Fig. 33A) and a human κ C region; C. difficile antitoxin A hmAb comprising a H chain polypeptide sequence comprising a VH region of SEQ ID NO: 1 (Fig. 32A) and a human IgG1 C region and a L chain polypeptide comprising a VL region of SEQ ID NO: 4 (Fig. 33B) and a human κ C region; and C. difficile antitoxin A hmAb comprising a H chain polypeptide sequence comprising a VH region of SEQ ID NO: 2 (Fig. 32B) and a human IgG 1 C region and a L chain polypeptide sequence comprising a VL region of SEQ ID NO: 4 (Fig. 33B) and a human κ C region. Such humanized C. difficile antitoxin A mAbs contain an PA-39 hmAb (hPA-39) of the invention.
164/183
Complete hPA-39 immunoglobulin that has two L chains and two H chains can be produced in a host cell that co-expresses and secretes an hPA-39 H chain polypeptide composed of a VH region of the invention (for example, SEQ ID NO : 1; SEQ ID NO: 2) and a suitable CH region, for example, of the lgG1 isotype, as contained within Genbank Accession No. NW_001838121 and an hPA-39 L chain polypeptide composed of a VL region of hPA-39 of the invention (for example, SEQ ID NO: 3; SEQ ID NO: 4) and a suitable CL region, for example, of subtype k, as contained within Genbank Accession No. NW_001838785.
Other examples of humanized C. difficile antitoxin A mAbs of the invention include humanized C. difficile antitoxin A mAb comprising a H chain polypeptide sequence comprising a VH region of SEQ ID NO: 5 (Fig. 34A) and a C region human IgG1 and an L chain polypeptide sequence comprising a VL region of SEQ ID NO: 7 (Fig. 35) and a human κ C region; and humanized C. difficile antitoxin A mAb comprising a H chain polypeptide sequence comprising a VH region of SEQ ID NO: 6 (Fig. 34B) and a human IgG1 C region and a L chain polypeptide sequence comprising a VL region of SEQ ID NO: 7 (Fig. 35) and a human κ C region. Such humanized C. difficile antitoxin A mAbs contain a humanized mAb PA-50 (hPA-50) of the invention. Complete hPA-50 immunoglobulin having two L chains and two H chains can be produced in a suitable host cell that co-expresses and secretes an hPA-50 H chain polypeptide composed of a VH region of the invention (for example, SEQ ID NO: 5; SEQ ID NO: 6) and a suitable CH region, for example, of the lgG1 isotype, as contained within Genbank Accession No. NW_001838121 and an hPA-50 L chain polypeptide composed of a region VL of the invention (SEQ ID NO: 7) and a CL region, for example, of the κ subtype, as contained within Genbank Accession No. NW_001838785.
The humanization process still provides antitoxin mAbs
165/183
B of humanized C. difficile that bind to toxin B and neutralize the activity of toxin B on susceptible cells in vitro. Examples of such hmAbs include humanized C. difficile antitoxin B mAb comprising a H chain polypeptide sequence comprising a VH region of SEQ ID NO: 8 (Fig. 36A) and a human IgG1 C region and a chain polypeptide sequence L comprising a VL region of SEQ ID NO: 10 (Fig. 37) and a human κ C region; and humanized C. difficile antitoxin B mAb comprising a H chain polypeptide sequence comprising a VH region of SEQ ID NO: 9 (Fig. 36B) and a human IgG1 C region and a L chain polypeptide sequence comprising a VL region of SEQ ID NO: 10 (Fig. 37) and a human κ C region. Such humanized C. difficile antitoxin B mAbs contain a humanized PA-41 mAb (hPA-41) of the invention. Complete hPA-41 immunoglobulin having two L chains and two H chains can be produced in a suitable host cell that co-expresses and secretes an hPA-41 H chain polypeptide composed of an hPA-41 VH region of the invention (for example, example, SEQ ID NO: 8; SEQ ID NO: 9) and a suitable CH region, for example, of the lgG1 isotype, as contained within Genbank Accession No. NW_001838121 and an hPA-41 L-chain polypeptide composed of an hPA-41 VL region of the invention (for example, SEQ ID NO: 10) and a CL region, for example, of the κ subtype, as contained within Genbank Accession No. NW_001838785.
In addition, humanized, cloned mAbs (hmAbs) were produced that bind to toxin A or C. difficile toxin B and strongly neutralize the activity of the toxin. hmAb PA-50 antitoxin A from C. difficile is composed of two heavy chain polypeptides, each heavy chain containing a VH region and a human CH region and two heavy chain polypeptides, each light chain containing a VL region and a human CL region . The nucleic acid sequence (or cDNA) encoding the amino acid sequence of the hPA-50 heavy chain polypeptide of SEQ ID NO: 14 is shown in SEQ ID NO: 15, (Fig. 38B); the nucleic acid sequence (or cDNA) encoding the polypeptide amino acid sequence
166/183 hPA-50 light chain deo SEQ ID NO: 16 is shown in SEQ ID NO: 17. (Fig. 38A). hmAb PA-39 antitoxin A from C. difficile is composed of two heavy chain polypeptides, each heavy chain containing a VH region and a human CH region and two heavy chain polypeptides, each light chain containing a VL region and a human CL region . The nucleic acid sequence (or cDNA) encoding the amino acid sequence of the hPA-39 heavy chain polypeptide of SEQ ID NO: 18 is shown in SEQ ID NO: 19, (Fig. 39B); the nucleic acid sequence (or cDNA) encoding the amino acid sequence of the hPA-39 light chain polypeptide of SEQ ID NO: 20 is shown in SEQ ID NO: 21 (Fig. 39A). hmAb PA-41 antitoxin B from C. difficile is composed of two heavy chain polypeptides, each heavy chain containing a VH region and a human CH region and two heavy chain polypeptides, each light chain containing a VL region and a human CL region . The nucleic acid sequence (or cDNA) encoding the amino acid sequence of the hPA-41 heavy chain polypeptide of SEQ ID NO: 22 is shown in SEQ ID NO: 23 (Fig. 40B); the nucleic acid sequence (or cDNA) encoding the amino acid sequence of the hPA-41 light chain polypeptide of SEQ ID NO: 24 is shown in SEQ ID NO: 25 (Fig. 40A).
Monoclonal antibodies CDA-1 and CDB1 (7, 89) were prepared for use as comparative mAbs. DNA sequences encoding the 3D8 and 124 Ig heavy and light chain variable regions (WO2006 / 121422 and US2005 / 0287150) were synthesized (DNA2.0) and cloned into pCON-gama1 and pCON-kappa vectors. Full length lgG1, D mAbs were expressed in stably transfected and purified CHO-K1SV cells as described above. When tested for binding affinity to toxins A and B by Biacore, inhibition of toxin-mediated cytopathic effect and hemagglutination according to published methods (7), the CDA1 and CDB1 preparations exhibited the expected levels of activity.
E. In vitro characterization of humanized mAbs
C. difficile toxin neutralization experiments were repeated
167/183 used in vitro to compare the functional activity of humanized mAbs with that of mouse parental mAbs. As shown in Fig. 29, humanized PA-41 mAb (hPA-41) potently neutralized toxin B cytotoxicity (6 pM EC ₅ o) compared with a 9 pM EC ₅ o for murine PA-41 mAb ( mPA-41). Similarly, humanized mAb PA-39 (hPA-39) and humanized mAb PA-50 (hPA-50) were found to be equally potent when compared to their parental murine mAbs for neutralizing toxin A using CHO-K1 cells or T-84 cells, respectively, as shown in Fig. 30 for hPA-39 and Fig. 31 for hPA-50. These results demonstrate that the parental murine mAbs were successfully humanized and that the humanized mAbs were functional and efficient.
Of the C. difficile antitoxin mAbs examined in these studies, PA-50 exhibited a distinct dose-response neutralization curve with Hill coefficients that were typically greater than two, indicating cooperative inhibition. Cooperative interactions are common in nature and are often characterized by gradual dose-response curves and Hill coefficients of> 1. Drugs that show cooperative activity have been associated with intensified clinical activity in the treatment of viral infections. In addition, PA-50 binds to toxin A in a multivalent way, a condition that is often necessary, but not sufficient for cooperativity.
Example 11
Generation of Fab fragments from the murine antitoxin mAbs of the invention
A. Preparation of Fab fragments
Fab fragmentation was performed using a lgG1 Fab and F (ab ') 2 Preparation Kit (Pierce) Mouse according to the manufacturer's instructions and reagents provided with the kit. The same protocol for fragmentation was used for all mAbs; PA-39, PA-41 and PA-50. Briefly, immobilized ficin paste (750 pL) was washed with digestion buffer (75 mM cysteine, pH 5.6) before approximately 3 mg mAb was added and the mixture was incubated at 37 ° C for four hours.
168/183 ras with constant end-over-end rotation. Once digestion was complete, the paste was centrifuged and the digestion product was collected. The slurry was washed three times with Protein A binding buffer and the wash material was added to the finished digestion. The NAb Protein A column was equilibrated with Protein A binding buffer and the digested antibody sample was added. The column and sample were incubated at room temperature for 10 minutes. The column was centrifuged at 1000 g for one minute to collect the bypass containing Fab fragments. The column was washed three times with Protein A binding buffer. The bypass was collected, the buffer exchanged for PBS and concentrated.
B. SDS-PAGE of Fab fragments
Samples were analyzed via SDS-PAGE using the Novex gel system (Invitrogen) and all reagents listed below were from Invitrogen, unless otherwise noted. Samples were mixed with NuPage sample buffer and reduced with DTT. Reduced and unreduced samples were incubated at 100 ° C for 10 minutes. After loading the samples (4 pg) in a 4-12% BisPis NuPage gel, electrophoresis was performed with MOPS operating buffer at 180V for 60 minutes. After electrophoresis, the gel was incubated with fixative (40% methanol, 10% acetic acid) for 20 minutes, rinsed with water and stained with Simply Blue dye overnight with constant rotation.
C, Characterization of Fabs in vitro
In vitro neutralization experiments for C. difficile toxin were performed to compare the functional activity of Fabs (A) with that of intact mAbs () based on the number of binding sites. The PA-39 Fab strongly neutralized toxin A cytotoxicity in CHO-K1 cells compared to intact PA-39 (EC50 of 880 pM and EC50 of 200 pM, respectively), (Fig. 41A). PA-41 Fab was found to be equally potent to intact PA-41 in neutralizing toxin B activity in CHO-K1 cells (EC ₅₀ of 88 pM and EC50 of 80 pM, respectively), (Fig. 41B) . The PA-50 Fab had an EC50 value of 1.8 nM compared
169/183 with an EC ₅ value of 100 pM of the intact mAb PA-50 neutralizing toxin A on T-84 cells (Fig. 41C).
Example 12
Immunohistochemical analysis of humanized anti-toxin mAbs from C. difficile on human tissue specimens
The value of immunohistochemistry (IHC) in the study of the expression of a given antigen is that it allows the evaluation of microanatomical detail and heterogeneity in normal and tumor tissues. IHC is advantageous over other methods of analysis because it can directly locate proteins to individual types of cells. Differences in gene expression in normal and tumor tissue can be detected while simultaneously observing changes in cell number and composition. Limitations of this technique include possible false negative results due to the low levels of expression of the molecule under study, as well as false positive results (cross-reactivity) due to antibody binding to similar epitopes or those epitopes shared by other antigens. To address these limitations, this study was performed in the lowest possible concentration of each of the antibodies that showed strong specific staining on mouse control specimens injected with specific positive toxin.
Humanized mAbs PA-41 and PA-50 were biotinylated to determine an immunohistochemical binding pattern in a selection of frozen human tissues, which included adrenal, bladder, bone marrow, breast, cerebellum, cerebral cortex, cervix, colon, esophagus, eye, fallopian tube, heart, ileum, jejunum, kidney, liver, lung, lymph node, muscle, ovary, peripheral nerve, pancreas, parathyroid, pituitary, placenta, prostate, skin, small intestine, spinal column, spleen, stomach, testis, thymus , thyroid, ureter, uterus and white blood cells. One tissue from each of the 37 different types of human tissue was stained with each antibody. Working IHC assays were developed for both antibodies. An irrelevant human IgG1, ü isotype control antibody was included for all samples.
170/183
For tissue preparation, frozen specimens embedded in OCT compound (Optimal Cutting Temperature Embedding Compound; Sakura, Torrance, CA) were divided into 5 microns and placed on positively charged glass slides. IHC staining methods and conditions for each antibody and tissue specimen have been developed, tested and optimized. A direct biotinylated IHC procedure was performed using freshly cut unfixed tissue sections. The sections were removed from the cryostat, allowed to air dry for 10 minutes at room temperature, fixed in 95% ethanol for 5 minutes at room temperature, and then washed in three sequential baths of Tris / Buffered Saline Wash Buffer 0.1% Tween-20 (TBST; DakoCitomation) for 3 minutes. All subsequent washes were performed in this manner. Endogenous peroxidase activity was blocked with a 5 minute incubation of Peroxidase Block ready for use at room temperature. After a buffer wash, the endogenous biotin activity was then blocked with 15-minute incubations of avidin each, followed by biotin, with each step followed by buffer washes. For PA-41, the slides were then incubated with Background Sniper protein blocking reagent for 10 minutes at room temperature without washing with buffer afterwards. The slides were incubated with the test article or negative control reagent (1.25 Dg / mL for PA-41 and 10 Dg / mL for PA-50) for 30 minutes at room temperature. The primary antibody PA-50 was diluted 1: 350 in Dako diluent, while the primary antibody PA-41 was diluted 1: 3520 in Dako diluent with proline (250 mM, 0.576 g, Genzyme, CA) and histidine (15 mM, 0.046 g, Genzyme, CA) added to 20 ml of diluent (pH 7.7). After washes in TBST, ABC detection reagent (1:50 in TBST) was applied to tissue sections for both antibody assays and incubated for 30 minutes at room temperature, followed by buffer washes. The immuno-reaction was visualized by incubating with a solution of 3.30-diaminobenzidine tetrachloride (DAB) for 5 minutes at room temperature. The slides were rinsed with deionized water (Dl) 3 times during
171/183
30-60 seconds each, counterstained with modified Mayers' hematoxylin (DakoCitomation), dyed with 0.2% ammonia, dehydrated with various degrees of alcohol, cleaned with xylene and covered with a coverslip. The interpretation of stained slides was performed through microscopic examination. In general, a morphological review of the tissue on the slide after antibody staining determined whether an adequate amount of tissue was present and whether the designated normal tissue elements were properly represented. Samples that fail to meet the above standards were rejected from analysis by the study pathologist.
The classification system included a semi-quantitative analysis of staining intensity. The intensity of staining of the test article was judged in relation to the intensity of the tissue control section containing an adjacent section stained with a negative control antibody. Staining of the section marked with the negative reagent control was considered base staining. A score of 0 indicated no staining with respect to the base; 1+ indicated weak coloring; 2+ indicated moderate color; and 3+ indicated strong color. In accordance with standard practice in pathology, the intensity of staining was reported at the highest level of intensity observed in all tissue elements.
The results of the IHC analysis for the humanized mAbs PA-50 _and PA-41 were that no positive staining (0%) was displayed on any of the tested human tissue specimens. Consistent strong staining (eg, 3+) was indicated in toxin-injected mouse leg muscle control tissues (Toxin A for PA-50 and Toxin B for PA-41) throughout the study. For PA-50, no true positive staining was observed for any tissue sample (ie, 100% cells showed 0% staining). For PA-41, no true positive staining was shown in the 37 human tissues tested, however, weak positive staining (1+) was observed as the highest staining intensity in normal liver (due to the lipochrome pigment), normal lung (pulmonary macrophages) with a foreign body) and normal muscle (reaction consistent with artificial coloring). Such weak staining values for PA-41
172/183 were considered to be without consequences in relation to all controls and in view of the minimum color variation within the assay.
Example 13
Pharmacokinetic analysis of humanized C. difficile antitoxin mAbs in 5 non-human primates
A pharmacokinetic study (PK) in non-virgin Cynomolgus monkeys was conducted using the purified humanized mAbs PA-41 or PA-50. In this study, male, non-virgin Cynomolgus monkeys (Macaca fascicularis) were injected intravenously with 1 mg / kg / animal or 5 10 mg / kg / animal of humanized mAb PA-41 or purified mAb PA-50. The study was carried out in accordance with the rules and procedures of the Institutional Animal Care and Use Committee (IACUC).
Table 8 shows the format of the PK study, showing that each mAb (at a concentration of 10 mg / kg) was administered intravenously15 at two dose levels to non-virgin animals.
Table 8. PK study of humanized mAb in non-human primates
Group Treatment Via Dose level (mg / kg / day) Concentration (mg / kg) Dose Volume (mL / kg / day) No. of Monkeys (males) 1 PA-41 IV 1 10 0.1 3 2 PA-41 IV 5 10 0.5 3 3 PA-50 IV 1 10 0.1 3 4 PA-50 IV 5 10 0.5 3
The animals received a single intravenous injection of study antibody at the start of the study. Thereafter, blood samples were obtained by venipuncture of peripheral vessels of each animal 20 at 14 individual time points within 29 days (ie, pre-dose; at 0.5, 2, 6, 12 and 24 hours on day 1 (post-dose); and on days 3, 4, 7, 9, 12, 15, 22 and 29). Blood samples were collected in serum separating tubes and kept on wet ice until coagulation. After coagulation, blood samples were centrifuged at 1800 g for 15 minutes at 4 ° C to obtain sera. Serum samples were stored at -70 ° C until use.
173/183
The concentration of mAb in the sera was determined by ELISA. Ninety-six well ELISA slides (Thermo Fisher Scientific, Rochester, NY) were coated overnight with toxin A (Techlab) or toxin B (Techlab) at 100 ng / well at 4 ° C. The slides were washed three times with PBS / 0.05% Tween-20® (PBS-T) and blocked with 200 µl of blocking buffer (PBS without calcium or magnesium, 0.1% Tween 20®, casein a 1%) for one hour at room temperature. The antibody reference standard (mAb PA-41 or purified mAb PA-50) was diluted in virgin cynomolgus serum pooled at 1% (Bioreclamation) to generate a standard curve with a range of 0.3 - 4000 ng / mL. Diluted test samples and standards were tested in triplicate and were incubated for one hour at room temperature.
The slides were washed six times with PBS-T and incubated for one hour at room temperature with goat anti-human IgG1 HRP-conjugated antibody (The Binding Site, San Diego, CA). The slides were developed with peroxidase substrate with 1 component SureAzul TMB 1 (KPL), stopped with 1N hydrochloric acid (Thermo Fisher Scientific) and read on a SpectraMax Plate Reader (Molecular Devices) at 450 nm. The concentration of mAb in each monkey at different time points was calculated using standard curves. Non-compartmental pharmacokinetic analysis was performed using WinNonLin, Version 4.0 (Pharsight Corp., Mountain View, CA). The PK results for the humanized mAb PA-50 are shown in Fig. 42A; the results for the humanized mAb PA-41 are shown in Fig. 42B. For PA-50 in doses of 1 mg / kg and 5 mg / kg, ο T _V2 mean (Days) was 14.5 □ 0.3 and 12.3 □ 1.5, respectively. For PA-41 in doses of 1 mg / kg and 5 mg / kg, the mean Ti / ₂ (Days) was 8.9 □ 1.3 and 9.2 □ 3.3, respectively.
References
1. Bartlett, J. G., T. W. Chang, M. Gurwith, S. L. Gorbach and A. B. Onderdonk. 1978. Antibiotic-associated pseudomembranous colitis due to toxin-producing Clostridia. The New England Journal of Medicine 298: 531-534.
174/183
2. Kyne, L., R. J. Farrell and C. P. Kelly. 2001. Clostridium difficile. Gastroenterol. Clin North Am 30: 753-777.
3. Kelly, C. P. and J. T. LaMont. 2008. Clostridium difficile-more difficult than ever. The New England Journal of Medicine 359: 1932-1940.
4. MacCannell, D. R „T. J. Louie, D. B. Gregson, M. Laverdiere, A. C. Labbe, F. Laing and S. Henwick. 2006. Molecular analysis of Clostridium difficile PCR ribotype 027 isolates from Eastern and Western Canada. J Clin Microbiol 44: 2147-2152.
5. McDonald, L. C., G. E. Killgore, A. Thompson, R. C. Owens, Jr., S. V. Kazakova, S. P. Sambol, S. Johnson and D. N. Gerding. 2005. An epidemic, toxin gene-variant strain of Clostridium difficile. The New England Journal of Medicine 353: 2433-2441.
6. Warny, M., J. Pepin, A. Fang, G. Killgore, A. Thompson, J. Brazier, E. Frost and L. C. McDonald. 2005. Toxin production by an emerging strain of Clostridium difficile associated with outbreaks of severe disease in North America and Europe. Lancet 366: 1079-1084.
7. Babcock, GJ, TJ Broering, HJ Hernandez, RB Mandell, K. Donahue, N. Boatright, AM Stack, I. Lowy, R. Graziano, D. Molrine, DM Ambrosino and WD Thomas, Jr. 2006. Human monoclonal antibodies directed against toxins A and B prevent Clostridium difficile-induced mortality in hamsters. Infect Immun 74: 6339-6347.
8. Bartlett, J. G. 1981. Antimicrobial agents implicated in Clostridium difficile toxin-associated diarrhea of colitis. Johns Hopkins Med J 149: 6-9.
9. McFarland, L. V., Μ. E. Mulligan, R. Y. Kwok and W. E. Stamm. 1989. Nosocomial acquisition of Clostridium difficile infection. The New England Journal of Medicine 320: 204-210.
10. Zilberberg, M. D., A. F. Shorr and Μ. H. Kollef. 2008. Increase in adult Clostridium difficile-related hospitalizations and case-fatality rate, United States, 2000-2005. Emerg. Infect Dis 14: 929-931.
11. Riley, T. V., Codde, J. P. and Rous, I. L. Increased length of hospital stay due to Clostridium difficile-associated diarrhoea. Lancet 345,
175/183
455-456. 2-18-1995.
12. O'Brien, J. A., B. J. Lahue, J. J. Caro and D. M. Davidson.
2007. The emerging infectious challenge of Clostridium difficile-associated disease in Massachusetts hospitals: clinical and economic consequences. Infect Control Hosp Epidemiol. 28: 1219-1227.
13. Redelings, M. D., F. Sorvillo and L. Mascola. 2007. Increase in Clostridium difficile-related mortality rates, United States, 1999-2004. Emerg. Infect Dis 13: 1417-1419.
14. Loo, V. G., L. Poirier, M. A. Miller, M. Oughton, M. D. Libman,
S. Michaud, AM Bourgault, T. Nguyen, C. Frenette, M. Kelly, A. Vibien, P. Brassard, S. Fenn, K. Dewar, TJ Hudson, R. Horn, P. Rene, Y. Monczak and A. Dascal. 2005. A predominantly clonal multi-institutional outbreak of Clostridium difficile-associated diarrhea with high morbidity and mortality. The New England Journal of Medicine 353: 2442-2449.
15. Warny, Μ. K. C. 2003. Pathogenicity of Clostridium difficile toxins. Washington DC: ASM Press 366: 503-524.
16. Kelly, C.P., C. Pothoulakis and J. T. LaMont. 1994. Clostridium difficile colitis. The New England Journal of Medicine 330: 257-262.
17. Lyerly, D. M., D. E. Lockwood, S. H. Richardson and T. D. Wilkins. 1982. Biological activities of toxins A and B of Clostridium difficile. Infect Immun. 35: 1147-1150.
18. McFarland, L. V., H. W. Beneda, J. E. Clarridge and G. J. Raugi. 2007. Implications of the changing face of Clostridium difficile disease for health care practitioners. Am J Infect Control 35: 237-253.
19. Drudy, D., T. Quinn, R. O'Mahony, L. Kyne, P. O'Gaora and S. Fanning. 2006. High-level resistance to moxifloxacin and gatifloxacin associated with a novel mutation in gyrB in toxin-A-negative, toxin-B-positive Clostridium difficile. J Antimicrob Chemother 58: 1264-1267.
20. Rupnik, Μ., N. Kato, M. Grabnare H. Kato. 2003. New types of toxin A-negative, toxin B-positive strains among Clostridium difficile isolates from Asia. J Clin Microbiol 41: 1118-1125.
21. Voth, D. E. and J. D. Ballard. 2005. Clostridium difficile toxins:
176/183 mechanism of action and role in disease. Clin Microbiol Rev 18: 247-263.
22. Reineke, J., S. Tenzer, M. Rupnik, A. Koschinski, O. Hasselmayer, A. Schrattenholz, H. Schild and C. Eichel-Streiber. 2007. Autocatalytic cleavage of Clostridium difficile toxin B. Nature 446: 415-419.
23. Aslam, S., R. J. Hamill and D. M. Musher. 2005. Treatment of Clostridium difficile-associated disease: old therapies and new strategies. Lancet Infect Dis 5: 549-557.
24. Musher, D.M., S. Aslam, N. Logan, S. Nallacheru, I. Bhaila,
F. Borchert and R. J. Hamill. 2005. Relatively poor outcome after treatment of Clostridium difficile colitis with metronidazole. Clin Infect Dis 40: 1586-1590.
25. Pepin, J., Μ. E. Alary, L. Valiquette, E. Raiche, J. Ruel, K. Fulop, D. Godin and C. Bourassa. 2005. Increasing risk of relapse after treatment of Clostridium difficile colitis in Quebec, Canada. Clin Infect Dis 40: 1591-1597.
26. Fekety, R. and A. B. Shah. 1993. Diagnosis and treatment of Clostridium difficile colitis. JAMA 269: 71-75.
27. Fekety, R., L. V. McFarland, C. M. Surawicz, R. N. Greenberg, G. W. Elmer and Μ. E. Mulligan. 1997. Recurrent Clostridium difficile diarrhea: characteristics of and risk factors for patients enrolled in a prospective, randomized, double-blinded trial. Clin Infect Dis 24: 324-333.
28. Pothoulakis, C. and J. T. LaMont. 1993. Clostridium difficile colitis and diarrhea. Gastroenterol. Clin North Am 22: 623-637.
29. McFarland, L. V., C. M. Surawicz, R. N. Greenberg, R. Fekety, G. W. Elmer, K. A. Moyer, S. A. Melcher, Κ. E. Bowen, J. L. Cox, Z. Noorani e. 1994. A randomized placebo-controlled trial of Saccharomyces boulardii in combination with standard antibiotics for Clostridium difficile disease. JAMA 271: 1913-1918.
30. McFarland, L. V., G. W. Elmer and C. M. Surawicz. 2002. Breaking the cycle: treatment strategies for 163 cases of recurrent Clostridium difficile disease. Am J Gastroenterol. 97: 1769-1775.
31. Kyne, L., M. Warny, A. Qamar and C. P. Kelly. 2000. Asymptomatic carriage of Clostridium difficile and serum levels of IgG antibody a-
177/183 gainst toxin A. The New England Journal of Medicine 342: 390-397.
32. Kyne, L., M. Warny, A. Qamar and C. P. Kelly. 2001. Association between antibody response to toxin A and protection against recurrent Clostridium difficile diarrhoea. Lancet 357: 189-193.
33. Leav, B., Blair, B., Leney, M., Knauber, M., Reilly, C., Lowy, I., Kohberger, R., Gerding, DN, Kelly, C., Katchar, K. , Baxter, R. and Ambrosino, D. 2008. Serum anti-toxin B antibody correlates with protection from recurrent Clostridium difficile associated diarrhea (CDAD). ICAAC / IDSA, Poster B-1295. 2008.
34. Wilcox, Μ. H., W. N. Fawley, C. D. Settle and A. Davidson. 1998. Recurrence of symptoms in Clostridium difficile infection-relapse or reinfection J Hosp Infect 38: 93-100.
35. Jodlowski, T. Z., R. Oehler, L. W. Kam and I. Melnychuk. 2006. Emerging therapies in the treatment of Clostridium difficile-associated disease. Ann. Pharmacother 40: 2164-2169.
36. Missaghi, B., A. J. Valenti and R. C. Owens, Jr. 2008. Clostridium difficile Infection: A Critical Overview. Curr. Infect Dis Rep 10: 165-173.
37. Optimer Pharmaceuticals, News Release, November 10.
2008.
38. Louie, TJ, J. Peppe, CK Watt, D. Johnson, R. Mohammed, G. Dow, K. Weiss, S. Simon, JF John, Jr., G. Garber, S. Chasan-Taber and DM Davidson. 2006. Tolevamer, a novel nonantibiotic polymer, compared with vancomycin in the treatment of mild to moderately severe Clostridium difficile-associated diarrhea. Clin Infect Dis 43: 411-420.
39. Louie, T. G. M. G. D. e. al. 2007. Results of a phase III trial comparing tolevamer, vancomycin and metronidazole in patients with Clostridium difficile-associated diarrhea (CDI). 47th Interscience Conference on Antimicrobial Agents and Chemotherapy.
40. Kelly, C. P., C. Pothoulakis, J. Orellana and J. T. LaMont. 1992. Human colonic aspirates containing immunoglobulin A antibody to Clostridium difficile toxin A inhibit toxin A-receptor binding. Gastroenterology 102: 35-40.
178/183
41. Salcedo, J., S. Keates, C. Pothoulakis, M. Warny, I. Castagliuolo, J. T. LaMonte C. P. Kelly. 1997. Intravenous immunoglobulin therapy for severe Clostridium difficile colitis. Gut 41: 366-370.
42. Leung, D. Y., C. P. Kelly, M. Boguniewicz, C. Pothoulakis, J. T. LaMont and A. Flores. 1991. Treatment with intravenously administered gamma globulin of chronic relapsing colitis induced by Clostridium difficile toxin. J Pediatr 118: 633-637.
43. Medarex and Massachusetts Biologic Laboratories, News Release, November 3. 2008.
44. Kamiya, S., K. Yamakawa, X. Q. Meng, H. Ogura and S. Nakamura. 1991. Production of monoclonal antibody to Clostridium difficile toxin A which neutralizes enterotoxicity but not haemagglutination activity. FEMS Microbiol Lett 65: 311-315.
45. Kink, J. A. and J. A. Williams. 1998. Antibodies to recombinant Clostridium difficile toxins A and B are an effective treatment and prevent relapse of C. difficile-associated disease in a hamster model of infection. Infect Immun 66: 2018-2025.
46. Lyerly, D. M., C. J. Phelps, J. Toth and T. D. Wilkins. 1986. Characterization of toxins A and B of Clostridium difficile with monoclonal antibodies. Infect Immun 54: 70-76.
47. Harlow, E. and Lane, D. Antibodies, a laboratory manual. Cold Spring harbor Laboratory Press, Cold Spring harbor, New York. 1988.
48. Clark, G. F., H. C. Krivan, T. D. Wilkins and D. F. Smith. 1987. Toxin A from Clostridium difficile binds to rabbit erythrocyte glycolipids with Gal alpha terminal 1-3Gal beta 1-4GlcNAc sequences. Arch Biochem Biophys 257: 217-229.
49. Anton, P. Μ., M. O'Brien, E. Kokkotou, B. Eisenstein, A. Michaelis, D. Rothstein, S. Paraschos, C. P. Kelly and C. Pothoulakis. 2004. Rifalazil treats and prevents relapse of Clostridium difficile-associated diarrhea in hamsters. Antimicrob Agents Chemother 48: 3975-3979.
50. Boss, S. M., C. L. Gries, B. K. Kirchner, G. D. Smith and P. C. Francis. 1994. Use of vancomycin hydrochloride for treatment of Clostridium
179/183 difficile enteritis in Syrian hamsters. Lab Anim Sci 44: 31-37.
51. Freeman, J., S. D. Baines, D. Jabes and Μ. H. Wilcox. 2005. Comparison of the efficacy of ramosplanin and vancomycin in both in vitro and in vivo models of clindamycin-induced Clostridium difficile infection. J Antimicrob Chemother 56: 717-725.
52. Kink, J. A. and J. A. Williams. 1998. Antibodies to recombinant Clostridium difficile toxins A and B are an effective treatment and prevent relapse of C. difficile-associated disease in a hamster model of infection. Infect Immun 66: 2018-2025.
53. Kokkotou, E., A. C. Moss, A. Michos, D. Espinoza, J. W. Cloud, N. Mustafa, M. O'Brien, C. Pothoulakis and C. P. Kelly. 2008. Comparative efficacies of rifaximin and vancomycin for treatment of Clostridium difficile-associated diarrhea and prevention of disease recurrence in hamsters. Antimicrob Agents Chemother 52: 1121-1126.
54. Kurtz, CB, EP Cannon, A. Brezzani, M. Pitruzzello, C. Dinardo, E. Rinard, DW Acheson, R. Fitzpatrick, P. Kelly, K. Shackett, AT Papoulis, PJ Goddard, RH Barker, Jr ., GP Palace and JD Klinger. 2001. GT160-246, a toxin binding polymer for treatment of Clostridium difficile colitis. Antimicrob Agents Chemother 45: 2340-2347.
55. McVay, C. S. and R. D. Rolfe. 2000. In vitro and in vivo activities of nitazoxanide against Clostridium difficile. Antimicrob Agents Chemother 44: 2254-2258.
56. Razaq, N., S. Sambol, K. Nagaro, W. Zukowski, A. Cheknis,
S. Johnson and D. N. Gerding. 2007. Infection of hamsters with historical and epidemic Bl types of Clostridium difficile. J Infect Dis 196: 1813-1819.
57. Fernie, D. S., R. O. Thomson, I. Batty and P. D. Walker. 1983. Active and passive immunization to protect against antibiotic associated caecitis in hamsters. Developmental Biology Standard 53: 325-332.
58. Giannasca, P. J ,, Z. X. Zhang, W. D. Lei, J. A. Boden, M. A. Giel, T. P. Monath and W. D. Thomas, Jr. 1999. Serum antitoxin antibodies mediate systemic and mucosal protection from Clostridium difficile disease in hamsters. Infect Immun 67: 527-538.
180/183
59. Kim, P. H., J. P. laconis and R. D. Rolfe. 1987. Immunization of adult hamsters against Clostridium difficile-associated ileocecitis and transfer of protection to infant hamsters. Infect Immun 55: 2984-2992.
60. Lyerly, D. Μ., E. F. Bostwick, S. B. Binion and T. D. Wilkins.
1991. Passive immunization of hamsters against disease caused by Clostridium difficile by use of bovine immunoglobulin G concentrate. Infect Immun 59: 2215-2218.
61. Kelly, C.P., C. Pothoulakis, F. Vavva, I. Castagliuolo, E. F. Bostwick, J. C. O'Keane, S. Keates and J. T. LaMont. 1996. Anti-Clostridium difficile bovine immunoglobulin concentrate inhibits cytotoxicity and enterotoxicity of C. difficile toxins. Antimicrobial Agents Chemother 40: 373-379.
62. Delmee, Μ., M. Homel and G. Wauters. 1985. Serogrouping of Clostridium difficile strains by slide agglutination. J Clin Microbiol 21: 323-327.
63. Delmee, Μ., V. Avesani, N. Delferriere and G. Burtonboy. 1990. Characterization of flagella of Clostridium difficile and their role in serogrouping reactions. J Clin Microbiol 28: 2210-2214.
64. Barbut, F., A. Richard, K. Hamadi, V. Chomette, B. Burghoffer and J. C. Petit. 2000. Epidemiology of recurrences or reinfections of Clostridium difficile-associated diarrhea. J Clin Microbiol 38: 2386-2388.
65. Carswell, C. I., G. L. Plosker and A. J. Wagstaff. 2001. Daclizumab: a review of its use in the management of organ transplantation. BioDrugs 15: 745-773.
66. Wiland, A. M. and B. Philosophe. 2004. Daclizumab induction in solid organ transplantation. Expert Opin Biol Ther 4: 729-740.
67. Fenton, C., L. J. Scott and G. L. Plosker. 2004. Palivizumab: a review of its use as prophylaxis for serious respiratory syncytial virus infection. Pediatrician. Drugs 6: 177-197.
68. Wu, H., D. S. Pfarr, Y. Tang, L. L. An, N. K. Patel, J. D. Watkins, W. D. Huse, P. A. Kiener and J. F. Young. 2005. Ultra-potent antibodies against respiratory syncytial virus: effects of binding kinetics and binding valence on viral neutralization. J Mol Biol 350: 126-144.
69. Romero, J. R. Palivizumab prophylaxis of respiratory syncyti
181/183 al virus disease from 1998 to 2002: results from four years of palivizumab usage. Pediatr.Infect.Dis 22, S46-S54. 2003.
70. Carter, P., L. Presta, C. M. Gorman, J. B. Ridgway, D. Henner, W. L. Wong, A. M. Rowland, C. Kotts, Μ. E. Carver and Η. M. Shepard.
1992. Humanization of an anti-p185HER2 antibody for human cancer therapy. Proc Natl Acad Sci USA 89: 4285-4289.
71. Emens, L. A. 2005. Trastuzumab: targeted therapy for the management of HER-2 / neu-overexpressing metastatic breast cancer. Am J Ther 12: 243-253.
72. Finn, R. S. and D. J. Slamon. 2003. Monoclonal antibody therapy for breast cancer: herceptin. Cancer Chemother Biol Response Modif. 21: 223-233.
73. Giles, F., E. Estey and S. O'Brien. 2003. Gemtuzumab ozogamicin in the treatment of acute myeloid leukemia. Cancer 982095-2104.
74. Siemoneit, K., S. Cardoso Mda, K. Koerner, A. Wolpl and B. Kubanek. 1995. Human monoclonal antibodies for the immunological characterization of a highly conserved protein domain of the hepatitis C virus glycoprotein E1. Clin Exp Immunol 101: 278-83.75. Casale, T. B. 2004. Omalizumab: an effective anti-IgE treatment for allergic asthma and rhinitis. Drugs Today (Bare.) 40: 367-376.
76. Holgate, S. T., R. Djukanovic, T. Casale and J. Bousquet. 2005. Anti-immunoglobulin E treatment with omalizumab in allergic diseases: an update on anti-inflammatory activity and clinical efficacy. Clin Exp Allergy 35: 408-416.
77. Presta, L. G., S. J. Lahr, R. L. Shields, J. P. Porter, C. M. Gorman, B. M. Fendly and P. M. Jardieu. 1993. Humanization of an antibody directed against IgE. The Journal of Immunology 151: 2623-2632.
78. Jordan, J. K. 2005. Efalizumab for the treatment of moderate to severe plaque psoriasis. Ann. Pharmacother 39: 1476-1482.
79. Werther, W. A., T. N. Gonzalez, S. J. O'Connor, S. McCabe,
B. Chan, T. Hotaling, M. Champe, J. A. Fox, P. M. Jardieu, P. W. Berman and L. G. Presta. 1996. Humanization of an anti-lymphocyte function-associated
182/183 antigen (LFA) -1 monoclonal antibody and reengineering of the humanized antibody for binding to rhesus LFA-1. The Journal of Immunology 157: 4986-4995.
80. Leonardi, C. L. 2004. Current concepts and review of efali5 zumab in the treatment of psoriasis. Dermatol. Clin 22: 427-435.
81. Ferrara, N., K. J. Hillan, Η. P. Gerber and W. Novotny. 2004. Discovery and development of bevacizumab, an anti-VEGF antibody for treating cancer. Nat Rev Drug Discov. 3: 391-400.
82. Presta, L. G., H. Chen, S. J. O'Connor, V. Chisholm, Y. G.
Meng, L. Krummen, M. Winkler and N. Ferrara. 1997. Humanization of an anti-vascular endothelial growth factor monoclonal antibody for the therapy of solid tumors and other disorders. Cancer Res 57: 4593-4599.
83. Steinman, L. 2005. Blocking adhesion molecules as therapy for multiple sclerosis: natalizumab. Nat Rev Drug Discov. 4: 510-518.
84. Fagnani, R. 1994. The immunogenicity of foreign monoclonal antibodies in human disease applications: problems and current approaches. Immunol Ser. 61: 3-22.
85. Mateo, C., E. Moreno, K. Amour, J. Lombardero, W. Harris and R. Perez. 1997. Humanization of a mouse monoclonal antibody that blocks the epidermal growth factor receptor: recovery of antagonistic activity. Immunotechnology. 3: 71-81.
86. Reichert, J. M., C. J. Rosensweig, L. B. Faden and M. C. Dewitz. 2005. Monoclonal antibody successes in the clinic. Nat Biotechnol 23: 1073-1078.
87. Stephens, S., S. Emtage, O. Vetterlein, L. Chaplin, C. Bebbington, A. Nesbitt, M. Sopwith, D. Athwal, C. Novak and M. Bodmer. 1995. Comprehensive pharmacokinetics of a humanized antibody and analysis of residual anti-idiotypic responses. Immunology 85: 668-674.
88. Co, M. S., N. M. Avdalovic, P. C. Caron, Μ. V. Avdalovic, D.
A. Scheinberg and C. Queen. 1992. Chimeric and humanized antibodies with specificity for the CD33 antigen. J Immunol. 148: 1149-1154.
89. Lowy, l. and others. 2010. Treatment with monoclonal antibodies
183/183 against Clostridium difficile toxins. N. Engl. J Med., 362, 197-205.
90. Babcock.G.J. and others. Human Monoclonal Antibodies Neutralize Toxins Produced by Epidemic Strains of Clostridium difficile, the Infectious Diseases Society of America 43rd Annual Meeting, October 6-9, 2005; San Francisco, California.
91. Optimer Pharmaceuticals Reports Positive Data from its North American Phase 3 CDI Study of OPT-80. Optimer Pharmaceuticals, Press Release (2008).
92. Rothman SW, Toxicon. 1988; 26 (6): 583-97.
93. W02005US0047100 to Diversa
94. Cheknis, AK. and others. Distribution of Clostridium difficile strains from a North American, European and Australian trial of treatment for
C. difficile infections: 2005-2007. Anaerobe 15: 230-233 (2009).
95. Gerding D, et al. Restriction endonuclease analysis (ΡΕΑ) typing of Clostridium difficile in a phase 3 treatment trial of fidaxomicin vs vancomycin: Decreased cure rate for epidemic BI / NAP1 / 027 strain. 49th Interscience Conference on Antimicrobial Agents and Chemotherapy, Abstract, L1-1642, San Francisco, CA, September 12-15, 2009
Although the invention has been described in detail for the purpose of illustration, it should be understood that such details are for that purpose only and variations can be made by those skilled in the art without departing from the spirit and scope of the invention which is defined by the following claims .
The contents of all references, patents and published patent applications cited throughout this patent application are hereby incorporated by reference.
The listing of any reference is not an admission that the reference is prior art.

权利要求:
Claims (22)
[1]
1. Monoclonal antibody, isolated antibody or an antigen-binding fragment, characterized by the fact that:
(a) specifically binds to C. difficile toxin B and cross-competes for binding with C. difficile toxin B with a monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA -9693; and / or (b) specifically binds to an C. difficile toxin B epitope defined by a monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9693; optionally where:
(i) the antibody or fragment thereof has an EC ₅ o value in the range 6 to 9.5 pM or an EC ₅ o 5 pM, for the in vitro toxin B neutralization assay, or (ii) the antibody or fragment thereof has neutralizing activity against toxin B produced by a hypervirulent strain of
C. difficile is determined by a value of EC ₅ which ranges from 1 to 6.5 Μ Γ ^{11 '10} M, or (iii) the epitope defined by the monoclonal antibody produced by hybridoma cell line deposited under No. ATCC Accession PTA-9693 comprises the N-terminal enzymatic domain of C. difficile toxin B, for example, comprising a 103 kDa and a 63 kDa fragment comprising the N-terminal enzyme domain of C. toxin B difficile;
or in which (c) specifically binds to C. difficile toxin A and which cross-competes for binding to C. difficile toxin A with a monoclonal antibody produced by a hybridoma cell line deposited under the Accession No. ATCC PTA-9692, PTA-9694 or PTA-9888; and / or (d) specifically binds to an C. difficile toxin A epitope defined by a monoclonal antibody produced by the cell line
[2]
2/19 hybridoma deposited under ATCC Accession No. PTA-9692, PTA9694 or PTA-9888; optionally where:
(i) antibody or fragment thereof has a neutralization value of EC ₅ o in the range of 93 pM to 30 nM or an EC ₅ o of 46 pM, for neutralization of toxin A in vitro, or (ii) Antibody or fragment it has neutralizing activity against toxin A from a hypervirulent C. difficile strain which is determined by an EC ₅ value ranging from 2.6 ^-12 to 7.7 ^-11 M or 7.7 ^-12 to 4.8 ' ⁸ M, or (iii) the epitope defined by the monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9692 comprises the translocation domain of C. difficile toxin A, or (iv) the epitope defined by the monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9694 comprises a C-terminal receptor epitope for C. difficile toxin A;
or in which (e) is a monoclonal antibody PA-41 (ATCC Accession No. PTA-9693) or an antigen-binding fragment thereof;
or in which (f) is a monoclonal antibody selected from:
(i) PA-39 (ATCC Accession No. PTA-9692) or an antigen-binding fragment thereof, (ii) PA-50 (ATCC Accession No. PTA-9694) or an antigen-binding fragment antigen thereof, or (iii) PA-38 (ATCC Accession No. PTA-9888) or an antigen-binding fragment thereof;
optionally in which the antibody or fragment that binds to its antigen:
(I) is in a chimeric or humanized form; and / or (II) is, or is from, a monoclonal antibody;
[3]
3/19 (III) is human;
(IV) is, or is comprised of a bispecific antibody;
(V) is selected from a Fab fragment, an F (ab ') 2 fragment or an Fv fragment; and / or (VI) is or comprises a single chain antibody.
2. Antibody or antigen-binding fragment according to claim 1, characterized by the fact that:
(a) Neutralizes the in vivo toxicity of toxin A or C. difficile toxin B, optionally where the antibody or antigen binding fragment neutralizes the in vivo toxicity of toxin A or C. difficile toxin:
(i) in an amount ranging from 1 pg to 1000 pg or from 1 mg / kg to 50 mg / kg, or (ii) in a selected dose of: (I) 2, 5, 10, 50 or 100 pg, or (II) 40 or 50 mg / kg; or (b) specifically binds to C. difficile toxin A, where the antibody or antigen-binding fragment, when administered to an individual infected with C. difficile, in combination with an isolated antibody or a fragment binding to antigen that specifically binds to C. difficile B toxin, optionally increases the individual's ability to survive, where the antibody or antigen-binding fragment that specifically binds to C. difficile B toxin is an antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9693, an antigen-binding fragment thereof or a humanized form thereof; or (c) specifically binds to C. difficile toxin B, wherein the antibody or antigen-binding fragment, when administered to an individual infected with C. difficile, in combination with an isolated antibody or a binding fragment antigen that specifically binds to C. difficile toxin A, optionally increases the individual's ability to survive, where the antibody or antigen-binding fragment that specifically binds to C. difficile toxin A is an anti
[4]
4/19 body produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9692, PTA-9694, or PTA-9888, an antigen-binding fragment thereof or a humanized form thereof; or (d) specifically binds to C. difficile toxin A, and when administered to an individual infected with C. difficile, in combination with an isolated antibody or antigen-binding fragment thereof that specifically binds to C. difficile toxin C. difficile, effect a cure rate of 50%, 60%, 70%, 80%, 90% or 100%; optionally, where the antibody or fragment that binds to its antigen neutralizes the in vivo toxicity of C. difficile toxin B at a selected dose of: (I) 2, 5, 10, 50 or 100 pg, or ( II) 40 or 50 mg / kg.
3. Bispecific antibody or antigen-binding fragment, characterized by the fact that it comprises:
(i) one or more of a monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9692, PTA-9694 or PTA-9888, a fragment of antigen binding thereof, a humanized version antibody or fragment that binds to its antigen, an antibody heavy chain variable domain or fragment that binds to its antigen and / or an antibody light chain variable domain or fragment that binds to its antigen; and (ii) a monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9693, an antigen-binding fragment of the same, a humanized version of antibody or fragment that binds to the antigen thereof , an antibody or fragment heavy chain variable domain that binds to its antigen; and / or an antibody light chain variable domain or fragment that binds to its antigen;
optionally, wherein, (i) the antibody comprises one or more of the ATCC Accession No. PTA-9692, PTA-9694 or PTA-9888, an antigen-binding fragment thereof, a humanized version of antibody or fragment that binds to its antigen, a heavy chain variable domain of anti
[5]
5/19 body or fragment that binds to its antigen and / or a variable light chain domain of antibody or fragment that binds to its antigen; and (ii) an isolated monoclonal antibody deposited under ATCC Accession No. PTA-9693, an antigen-binding fragment of it, a humanized version of antibody or fragment that binds to its antigen, a chain variable domain heavy antibody or fragment that binds to its antigen and / or a light chain variable domain of antibody or fragment that binds to its antigen.
4. Binding protein, characterized by the fact that it comprises at least two polypeptide chains that comprise binding sites for the binding of C. difficile toxin A and toxin B, wherein at least one polypeptide chain comprises a first variable domain of heavy chain, a second heavy chain variable domain and a heavy chain constant domain or part thereof; and at least one polypeptide chain comprises a first light chain variable domain, a second light chain variable domain and a light chain constant domain or part thereof, wherein the variable domains comprising the polypeptide chains form functional binding sites for toxin A and C. difficile toxin B, optionally, where:
(a) the first heavy chain variable domain and the first light chain variable domain form a functional binding site for C. difficile toxin A and the second heavy chain variable domain and the second light chain variable domain form a functional binding site for C. difficile toxin B; or (b) the first heavy chain variable domain and the first light chain variable domain form a functional binding site for C. difficile toxin B and the second heavy chain variable domain and the second light chain variable domain form a functional binding site for C. difficile toxin A; and / or (c) the binding protein comprises an Fc region; and / or (d) the binding protein neutralizes the toxicity of toxin A and
[6]
6/19 C. difficile toxin B; and / or (e) the binding protein has:
(i) a rate constant (Kon) for toxin A or selected toxin B of at least 10 ² M ^-1 s'¹; at least 10 ³ M ^-1 s'¹; at least 10 ⁴ M ^-1 s'¹; at least 10 ⁵ M ^-1 s'¹; at least 10 ⁶ M ^-1 s'¹; or at least 10 ⁷ M ¹ s ' ¹ , which is measured by surface plasmon resonance, and / or (ii) an off rate constant (Koff) for toxin A or selected toxin B of a maximum of 10' ³ s'¹; maximum 10V; at most 10 ' ⁵ s ^-1 ; or at most 10% ¹ , which is measured by surface plasmon resonance; and / or (f) the binding protein has a dissociation constant (K _D ) for toxin A or selected toxin B of a maximum of 10 ^-7 M; maximum 10 ' ⁸ M; maximum 10 ' ⁹ M; maximum 10 ^'10 M; maximum 10 ^'11 M; maximum 10 ^'12 M; or at most ^10'13 M.
5. Composition, characterized by the fact that it comprises:
(a) at least one antibody against toxin A selected from PTA-9692, PTA-9694 or PTA-9888, an antigen-binding fragment of the same or a humanized form thereof, at least one antibody against toxin B selected from PTA-9692 or PTA-9693, a fragment of binding to the antigen of it or a humanized form of it, optionally, in which:
(i) the composition further comprises a carrier, an excipient, a diluent or a pharmaceutically acceptable carrier, and / or (ii) the composition further comprises an additional therapeutic agent, for example, being selected from: metronizadol, vancomycin, fidaxomycin, nitazoxanide, rifaximin, ramosplanin or a combination thereof; or (b) an antibody, expression vector, host cell, bispecific antibody, binding protein or antigen binding fragment, as defined in any of the preceding claims, and a pharmaceutically acceptable carrier, excipient, diluent or vehicle , optionally:
[7]
7/19 (i) further comprises an additional therapeutic agent, such as, for example, an additional therapeutic agent selected from an antibiotic, antibacterial, bacteriocidal, or bacteriostatic, e.g., metronizadol, vancomycin, fidaxomycin, nitazoxanide, rifaximin, ramosplanin, or a combination thereof, and / or (ii) where the composition comprises:
(I) an antibody or antigen-binding fragment thereof, as defined in claim 1, items (a), (b), or (e); and (II) an antibody or antigen-binding fragment thereof, as defined in claim 1, items (c), (d), or (f).
6. Antibody or antigen-binding fragment thereof according to claim 1, items (a), (b), or (e); and antibody or antigen-binding fragment thereof, according to claim 1, items (c), (d), or (f), or composition according to claim 5, characterized by the fact that it is for use in:
(a) A process for treating C. difficile infection, C. difficile-associated disease or C. difficile-associated diarrhea (CDAD) in an individual, in which antibodies or antigen-binding fragments are administered at the same time or at different times; or (b) Process to inhibit or neutralize the toxicity of toxin A and C. difficile toxin B, which comprises subjecting the cell to a dose of an antibody or fragment thereof, inhibiting or neutralizing the toxin A of C difficile according to any one of claims 1 (a), (b) or (e), and an effective dose of an antibody or fragment thereof, inhibitory or neutralizing C. difficile toxin B, according to with any one of claims 1 (c), (d) or (f), wherein the antitoxin A antibody or antigen binding fragment thereof and the antitoxin B antibody or antigen binding fragment thereof are administered at the same time or at different times and, optionally, when:
(i) the cell is present in an individual and antibodies or antigen-binding fragments are administered to the individual
[8]
8/19 in an efficient amount to inhibit or neutralize the toxicity of toxin A and toxin B of C. difficile, and / or (ii) the antitoxin A antibody or antigen-binding fragment thereof and / or the antitoxin B antibody or antigen-binding fragment thereof are human or are in humanized or chimeric form; or (c) A process of inhibiting or neutralizing toxicity to a cell via a C. difficile toxin which comprises subjecting the cell to an efficient inhibiting or neutralizing dose of the C. difficile toxin of said composition, wherein, optionally, the cell is present in an individual and the composition is administered to the individual in an amount effective to inhibit or neutralize toxin A and C. difficile toxin B; or (d) The process of neutralizing toxins produced by a hypervirulent strain of C. difficile, which includes administration to an individual who needs it:
(i) an antibody or antigen-binding fragment thereof, according to claim 1, items (a), (b), or (e), and (ii) an antibody or antigen-binding fragment thereof, according to claim 1, items (c), (d), or (f), in an amount efficient to neutralize the toxins produced by the hypervirulent strain, optionally, in which:
(I) the antibodies or antigen-binding fragments thereof are administered at the same time or at different times, or (II) the toxins of the C. difficile hypervirulent lineage are toxin A and toxin B, as an example powder, in which the C. difficile hypervirulent strain is selected from one or more of BI / NAP1 / 027, tcdA- / tcdB +, isolates from outpatients, clinical isolates and frequent clinical isolates, as examples, selected from one or more CCL678, HMC553, Pitt45, CD196, montreal 5, montreal 7.1, MH5, Pitt2, CCL14137, UVA17, UVA30 / TL42 and Pitt7, or (III) where antibodies or fragments binding to the anti
[9]
9/19 geno of them are human or are in humanized or chimeric form; or (e) The process of treating an individual who is asymptomatic, but is susceptible to or at risk of contracting infection caused by C. difficile, a disease associated with C. difficile or diarrhea associated with C. difficile (CDAD), which comprises administration to the individual of:
(i) an antibody or antigen-binding fragment thereof, according to claim 1, items (a), (b) or (e), and (ii) an antibody or antigen-binding fragment thereof, according to according to claim 1, items (c), (d) or (f), in an amount efficient to treat the individual, optionally, in which the individual is hospitalized.
7. Monoclonal antibody or antigen-binding fragment, characterized by the fact that it neutralizes toxin A from a hypervirulent C. difficile strain that is determined by an EC ₅ value ranging from 7.7 ^-12 M to 4.8 ^-8 M and / or neutralizes toxin B from a hypervirulent C. difficile strain which is determined by an EC ₅ value ranging from 1, T ¹¹ M to 6.5 ^-10 M, optionally in what:
(a) the antibody is produced by a hybridoma cell line deposited under ATCC Accession No. PTA-9692, PTA-9693, PTA-9694 or PTA-9888, for example, where the antibody produced by the lineage of hybridoma cells deposited under ATCC Accession No. PTA-9692, PTA-9693, PTA-9694 or PTA-9888, was humanized; and / or (b) the C. difficile hypervirulent strain is selected from one or more of BI / NAP1 / 027, CCL678, HMC553, Pitt45, CD196, montreal 5, montreal 7.1, MH5, Pitt2, CCL14137, UVA17, UVA30 / TL42 and Pitt7, or (c) the antibody or fragment that binds to its antigen is human or is in humanized or chimeric form.
8. Monoclonal antibody, characterized by the fact that it is generated against:
(a) C. difficile toxin A, which is composed of two heavy chain polypeptides, each heavy chain containing a VH region
[10]
10/19 comprising a consecutive amino acid sequence which is shown in SEQ ID NO: 1 and a human CH region and two light chain polypeptides, each light chain containing a VL region comprising a consecutive amino acid sequence which is presented in SEQ ID NO: 3 and a human CL region; or (b) C. difficile toxin A, which is composed of two heavy chain polypeptides, each heavy chain containing a VH region comprising a consecutive amino acid sequence that is shown in SEQ ID NO: 2 and a region Human CH and two light chain polypeptides, each light chain containing a VL region comprising a consecutive amino acid sequence that is shown in SEQ ID NO: 3 and a human CL region; or (c) C. difficile toxin A, which is composed of two heavy chain polypeptides, each heavy chain containing a VH region comprising a consecutive amino acid sequence that is shown in SEQ ID NO: 1 and a region Human CH and two light chain polypeptides, each light chain containing a VL region comprising a consecutive amino acid sequence that is shown in SEQ ID NO: 4 and a human CL region; or (d) C. difficile toxin A, which is composed of two heavy chain polypeptides, each heavy chain containing a VH region comprising a consecutive amino acid sequence that is shown in SEQ ID NO: 2 and a region Human CH and two light chain polypeptides, each light chain containing a VL region comprising a consecutive amino acid sequence that is shown in SEQ ID NO: 4 and a human CL region; or (e) C. difficile toxin A, which is composed of two heavy chain polypeptides, each heavy chain containing a VH region comprising a consecutive amino acid sequence that is shown in SEQ ID NO: 5 and a region Human CH and two light chain polypeptides, each light chain containing a VL region comprising a consecutive amino acid sequence that is shown in
[11]
11/19
SEQ ID NO: 7 and a human CL region; or (f) C. difficile toxin A, which is composed of two heavy chain polypeptides, each heavy chain containing a VH region comprising a consecutive amino acid sequence that is shown in SEQ ID NO: 6 and a region Human CH and two light chain polypeptides, each light chain containing a VL region comprising a consecutive amino acid sequence that is shown in SEQ ID NO: 7 and a human CL region; or (g) C. difficile toxin B, which is composed of two heavy chain polypeptides, each heavy chain containing a VH region comprising a consecutive amino acid sequence that is shown in SEQ ID NO: 8 and a region Human CH and two light chain polypeptides, each light chain containing a VL region comprising a consecutive amino acid sequence that is shown in SEQ ID NO: 10 and a human CL region; or (h) C. difficile toxin B, which is composed of two heavy chain polypeptides, each heavy chain containing a VH region comprising a consecutive amino acid sequence that is shown in SEQ ID NO: 9 and a region Human CH and two light chain polypeptides, each light chain containing a VL region comprising a consecutive amino acid sequence that is shown in SEQ ID NO: 10 and a human CL region; optionally, where the CH region is selected from lgG1, lgG2a, lgG2b, lgG3, lgG4, IgA, IgE or IgM; and / or the CL region is selected from the κ or λ isotype.
9. Antibody against C. difficile, characterized by the fact that it is:
(a) an antibody against C. difficile toxin A or a fragment thereof, wherein the L chain V region comprises an amino acid sequence selected from one or more of SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 7; or (b) an antibody against C. difficile toxin B or a fragment thereof, wherein the V region of the L chain comprises an amino acid sequence that is shown in SEQ ID NO: 10; or
[12]
12/19 (c) an antibody against C. difficile toxin A or a fragment thereof, wherein the V region of the H chain comprises an amino acid sequence selected from one or more of SEQ ID NO: 1, SEQ ID NO : 2, SEQ ID NO: 5 and SEQ ID NO: 6; or (d) an antibody against C. difficile toxin B or a fragment thereof, wherein the V region of the H chain comprises an amino acid sequence selected from one or more of SEQ ID NO: 8 or SEQ ID NO: 9 .
10. Monoclonal antibody or fragment thereof, characterized by the fact that it is generated against:
(a) C. difficile toxin A, wherein the antibody is composed of two heavy chain polypeptides, each heavy chain containing a VH region and a human CH region and two light chain polypeptides, each light chain containing a VL region and a human CL region, in which the heavy chain polypeptide comprises a consecutive amino acid sequence, the amino acid sequence of which is shown in SEQ ID NO: 14 and in which the light chain polypeptide comprises a consecutive amino acid sequence, whose amino acid sequence it is presented in SEQ ID NO: 16; or (b) C. difficile toxin A, wherein the antibody is composed of two heavy chain polypeptides, each heavy chain containing a VH region and a human CH region and two light chain polypeptides, each light chain containing a VL region and a human CL region, in which the heavy chain polypeptide comprises a consecutive amino acid sequence, the amino acid sequence of which is shown in SEQ ID NO: 18 and in which the light chain polypeptide comprises a consecutive amino acid sequence, whose sequence of amino acids is shown in SEQ ID NQ: 20; or (c) C. difficile toxin B, wherein the antibody is composed of two heavy chain polypeptides, each heavy chain containing a VH region and a human CH region and two light chain polypeptides, each light chain containing a VL region and a human CL region, wherein the heavy chain polypeptide comprises an amino acid sequence
[13]
13/19 of the consecutive, whose amino acid sequence is shown in SEQ ID NO: 22 and where the light chain polypeptide comprises a consecutive amino acid sequence, whose amino acid sequence is shown in SEQ ID NO: 24;
optionally, where the antibody heavy chain is of the IgG class, for example, the IgG1 class and / or the antibody light chain is of the k isotype.
11. Isolated antibody or antigen-binding fragment, characterized by the fact that it inhibits, blocks or prevents:
(a) the toxicity of C. difficile toxin B by binding to an epitopic site in the toxin B enzyme N-terminal region, where:
(i) the antibody is a monoclonal antibody, such as an antibody in humanized or chimeric form, or (ii) the antibody is PA-41 (ATCC Accession No. PTA-9693) or humanized PA-41, or (iii) the antibody competes with PA-41 (ATCC Accession No. PTA-9693) or humanized PA-41 for binding to the C. difficile toxin B enzyme Nterminal region, for example, where the antibody inhibits toxicity toxin B through a mixed competitive action mechanism; or (b) the toxicity of C. difficile toxin A by inhibiting, blocking or preventing internalization of toxin A and cytocellular toxicity, where:
(i) the antibody is a monoclonal antibody, such as a humanized or chimeric antibody, (ii) the antibody is PA-39 (ATCC Accession No. PTA-9692) or humanized PA-39, (iii) the antibody is PA-50 (ATCC Accession No. PTA-964) or humanized PA-50, (iv) the antibody competes with PA-39 (ATCC Accession No. PTA-9692), humanized PA-39, PA -50 (ATCC Accession No. PTA-9694) or humanized PA-50 by binding to toxin A, for example, where the
[14]
14/19 antibody:
(I) competes with PA-39 (ATCC Accession No. PTA-9692) or a humanized form of it by binding an isolated site in a toxin A region outside the toxin A receptor binding domain, optionally , inhibiting toxin A toxicity through a mixed competitive action mechanism or a competitive action mechanism, or (II) competes with PA-50 (ATCC Accession No. PTA-9694); or a humanized form of it by binding to at least two sites in the toxin A receptor binding domain.
12. Vaccine or immunogenic agent, characterized by the fact that it comprises parts, fragments or peptides of toxin A and / or toxin B of C. difficile that contain the epitopic regions recognized and / or linked by one or more monoclonal antibody PA- 39 (ATCC Accession No. PTA-9692); a humanized form of PA-39; monoclonal antibody PA-50 (ATCC Accession No. PTA-9694); a humanized form of PA-50; monoclonal antibody PA-41 (ATCC Accession No. PTA-9693); a humanized form of PA-41; an antibody that competes for the binding of toxin A with monoclonal antibody PA-39 or a humanized form thereof; an antibody that competes for the binding of toxin A with monoclonal antibody PA-50 or a humanized form thereof; or an antibody that competes for the binding of toxin B with monoclonal antibody PA-41 or a humanized form thereof, optionally, in which:
(a) the portions, fragments or peptides that contain toxin A and / or toxin B epitopes are derived from the toxin A or toxin B protein by proteolytic divination, such as, where the toxin A protein is proteolytically cleaved by an enterokinase and / or toxin B protein is proteolytically cleaved by a caspase;
(b) portions or fragments that contain epitopes are peptides chemically or recombinantly synthesized from the toxin A or toxin B protein;
(c) fragments that contain one or more epitopic regions or
[15]
15/19 sites recognized and linked by the antibody are derived from one or more of the amino terminals of toxin A; the amino terminal of toxin B; the carboxy terminal of toxin A; the carboxy terminal of toxin B; the toxin A receptor binding domain; a region outside the toxin A receptor binding domain; the toxin B receptor-binding domain; a region outside the toxin B receptor-binding domain; the N-terminal enzymatic region of toxin B; the toxin A glucosyltransferase domain; the toxin B glucosyltransferase domain; the proteolytic domain of toxin A; the proteolytic domain of toxin B; the hydrophobic pore-forming domain of toxin A; or the hydrophobic pore-forming domain of toxin B, such as fragments containing one or more epitopic regions or sites recognized and linked by the antibody are derived from a region outside, or within, the toxin A receptor binding domain or the N-terminal enzyme region of toxin B;
(d) fragments or portions containing toxin A and / or toxin B epitopes are <300 kDa in size, optionally, where fragments or portions containing toxin A and / or toxin B epitopes are -158 -160 kDa, -100-105 kDa, 103 kDa, -90-95 kDa, 91 kDa, -63-68 kDa, 63 kDa and / or 68 kDa in size, for example, where the fragments or portions that contain toxin A epitope have -158-160 kDa; -90-95 kDa, 91 kDa, -63-68 kDa and / or 68 kDa in size and / or fragments or portions containing toxin B epitope are -100-105 kDa, 103 kDa, -6368 kDa and / or 63 kDa in size; or (e) the vaccine or immunogenic agent is for use in a process to neutralize, inhibit, block, reduce, ameliorate, cure or treat C. difficile infections or C. difficile-associated disease in an individual in need thereof, comprising administering to the individual an effective amount of said vaccine or immunogenic agent, wherein the individual produces a humoral response to toxin A and / or toxin B of C. difficile, thereby neutralizing, inhibiting, blocking, reducing, improving, curing or treating diseases associated with C. difficile or CDAD in the individual.
13. Hybridoma cell line, characterized by the fact
[16]
16/19 that it was deposited under the ATCC accession number: PTA-9693, PTA-9692, PTA-9694 or PTA-9888.
14. Isolated nucleic acid, characterized by the fact that it has the sequence that is presented in:
(a) SEQ ID NO: 15, which encodes the heavy chain polypeptide having the amino acid sequence represented in SEQ ID NO: 14;
(b) SEQ ID NO: 17, which encodes the light chain polypeptide having the amino acid sequence represented in SEQ ID NO: 16;
(c) SEQ ID NO: 19, which encodes the heavy chain polypeptide having the amino acid sequence represented in SEQ ID NO: 18;
(d) SEQ ID NO: 21, which encodes the light chain polypeptide having the amino acid sequence represented in SEQ ID NQ: 20;
(e) SEQ ID NO: 23, which encodes the heavy chain polypeptide having the amino acid sequence represented in SEQ ID NO: 22; or (f) SEQ ID NO: 25, which encodes the light chain polypeptide that has the amino acid sequence represented in SEQ ID NO: 24.
15. Process of producing a monoclonal neutralizing antibody of C. difficile antitoxin A directed against C. difficile toxin A or a monoclonal anti-toxin B of C. difficile directed against toxin B of C. difficile, characterized by the fact that you understand:
(a) immunization of one or more recipient animals with inactive toxoid A at periodic intervals;
(b) reinforcement of animals with increasing amounts of active toxin A or active toxin B at periodic intervals; and (c) obtaining hybridoma cells from immune cells of the immunized and reinforced animals fused with a suitable immortalized cell line, in which the hybridoma cells produce and secrete anti-toxin A antibodies that neutralize C. difficile toxin A or anti-toxin B antibodies that neutralize C. difficile toxin B;
optionally further comprises:
(d) the isolation of monoclonal antibodies neutralizing toxin A from C. difficile or monoclonal antibodies neutralizing
[17]
17/19 C. difficile toxin B, for example, where:
(i) the immunization step (a) and the boost step (b) include administration of an adjuvant, (ii) the immunization step (a) and the boost step (b) are performed at periodic intervals of each three weeks, (iii) in step (a) recipient animals are immunized with two or three doses of toxoid A, or (iv) in step (b), recipient animals are boosted with three to five increasing doses of toxin A or of toxin B.
16. Kit, characterized by the fact that it comprises antibody or fragment that binds to its antigen, as defined in claim 1, items (a), (b), or (e), and / or antibody or fragment that binds to the antigen thereof, as defined in claim 1, items (c), (d), or (f), and instructions for use, optionally:
(a) in which the antibodies or antigen-binding fragments are contained in the same container in the kit or are contained in separate containers in the kit;
(b) further comprises a linker for the conjugation of antibodies or antigen-binding fragments thereof; and / or (c) further comprises an additional therapeutic agent, such as, for example, an antibiotic, antibacterial, bactericidal or bacteriostatic.
17. Expression vector, characterized by the fact that it comprises:
(a) at least one nucleic acid molecule encoding the antibody or antigen-binding fragment, as defined in claim 1;
(b) a nucleic acid molecule encoding the heavy chain or part thereof of the antibody or antigen-binding fragment, as defined in claim 1;
(c) a nucleic acid molecule encoding the light chain or part of it, the antibody or the antigen binding fragment, as
[18]
18/19 as defined in claim 1;
(d) at least one nucleic acid molecule encoding the heavy chain or part thereof and the light chain or part thereof, the antibody or antigen binding fragment, as defined in claim 1;
or a host cell transformed or transfected by said expression vector.
18. Ex vivo method, characterized by the fact that:
(a) Inhibiting or neutralizing the toxicity of a cell by toxin A and C. difficile toxin B, which comprises subjecting the cell to an effective inhibitory or neutralizing dose of an antibody or antigen-binding fragment against it. C. difficile toxin A according to claim 1, items (a), (b) or (e), and an effective inhibitory or neutralizing dose of an antibody or antigen-binding fragment thereof, against C. difficile toxin B according to claim 1, items (c), (d) or (f); or (b) neutralize, inhibit or block the activity of toxin B and / or toxin A on or against a cell susceptible to infection by C. difficile, comprising contact of the cell with an antibody, or antigen binding fragment thereof. according to claim 1, wherein the antibody, or the antigen-binding fragment thereof, neutralizes, inhibits or blocks the activity of toxin A and / or toxin B on or against the cell by a competitive mechanism of action or competitive mix of toxin inhibition; optionally where:
(i) the toxin is toxin A or toxin B, (ii) the toxin is toxin A and the mechanism of action is a competitive inhibiting mechanism of action, for example in which the antibody or the antigen-binding fragment thereof , is PA-50 (ATCC Accession No. PTA-9694), a humanized form of it or an antibody or fragment thereof, which competes with PA-50 to neutralize the activity of toxin A, (iii) the toxin is toxin A and the mechanism of action of inhibition with
[19]
19/19 mixed petitive, as for example, in which the antibody or antigen-binding fragment thereof is PA-39 (ATCC Accession No. PTA-9692), a humanized form of the same or an antibody or an fragment thereof, which competes with PA-39 to neutralize the activity of toxin A, or (iv) the toxin is toxin B and the mechanism of action is a mixed competitive inhibition mechanism, for example, in which the antibody or the antigen-binding fragment thereof, is PA-41 (ATCC Accession No. PTA-9693), a humanized form of it or an antibody or fragment thereof, which competes with PA-41 to neutralize the activity of toxin B.
19. Antibody, or antigen-binding fragment thereof according to claim 1, characterized by the fact that it is for use in a method as defined in claim 18, wherein the cell is is in an individual and the antibody, or the antigen-binding fragment thereof is administered in an effective amount to the individual.
[20]
20. Use of parts, fragments or peptides of toxin A and / or toxin B of C. difficile as defined in claim 12, characterized by the fact that it is to prepare a vaccine or immunogenic agent to neutralize, inhibit, block, reduce, improve, cure or treat a C. difficile infection or a disease associated with C. difficile in a subject in need of it.
[21]
21. Use of an antibody or an antigen-binding fragment thereof as defined in claim 1, characterized by the fact that it is to prepare a pharmaceutical composition for the treatment of: infection caused by C. difficile, a disease associated with C. difficile or diarrhea associated with C. difficile in an individual, in which antibodies or antigen-binding fragments are administered at the same time or at different times.
[22]
22. Invention, in any form of its embodiments or in any applicable category of claim, for example, product or process or use encompassed by the matter initially described, revealed or illustrated in the patent application.

类似技术:

---

公开号 | 公开日 | 专利标题

---

JP6159854B2|2017-07-05|Antibodies for the treatment of Clostridium difficile-related infections and diseases

---

US9994630B2|2018-06-12|Clostridium difficile antibodies

---

JP2018029625A|2018-03-01|Human antibody to clostridium difficile toxin

---

JP6495361B2|2019-04-03|Therapeutic use of specific ligands for MSRV-related diseases

---

BR112021001214A2|2021-04-27|antibody directed against the agglutination factor a | of s. aureus

---

US10450367B2|2019-10-22|Human antibodies against rabies and uses thereof

---

US10457721B2|2019-10-29|Anti-OSPA antibodies and methods of use

---

RU2630663C2|2017-09-11|Antibodies for treatment of infection and disease associated with clostridium difficile

---

NZ622798B2|2017-01-05|Clostridium difficile antibodies

同族专利:

---

公开号 | 公开日

---

EP2558493A4|2013-11-27|

---

ES2757675T3|2020-04-29|

---

US20150175681A1|2015-06-25|

---

EP2558493B1|2019-09-18|

---

US20130202618A1|2013-08-08|

---

CA2795953A1|2011-10-20|

---

CN102947334B|2017-12-26|

---

EP2558493A2|2013-02-20|

---

MX2012011926A|2013-01-29|

---

JP2017012166A|2017-01-19|

---

WO2011130650A3|2012-04-12|

---

CN102947334A|2013-02-27|

---

CA2795953C|2021-09-14|

---

US8986697B2|2015-03-24|

---

WO2011130650A2|2011-10-20|

---

MX339253B|2016-05-18|

---

JP2013523190A|2013-06-17|

---

AU2011239470B2|2015-09-10|

---

JP6159854B2|2017-07-05|

---

KR101820987B1|2018-01-22|

---

JP5965389B2|2016-08-03|

---

KR20130062279A|2013-06-12|

---

AU2011239470A1|2012-11-01|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US5292668A|1981-12-21|1994-03-08|Boston Biomedical Research Institute, Inc.|Bispecific antibody determinants|

---

US4879218A|1982-09-13|1989-11-07|Virginia Tech Intellectual Properties, Inc.|Antibody for C.difficile|

---

US6071517A|1986-07-07|2000-06-06|Medarex, Inc.|Bispecific heteroantibodies with dual effector functions|

---

GB8823869D0|1988-10-12|1988-11-16|Medical Res Council|Production of antibodies|

---

US5175384A|1988-12-05|1992-12-29|Genpharm International|Transgenic mice depleted in mature t-cells and methods for making transgenic mice|

---

US5530101A|1988-12-28|1996-06-25|Protein Design Labs, Inc.|Humanized immunoglobulins|

---

US6150584A|1990-01-12|2000-11-21|Abgenix, Inc.|Human antibodies derived from immunized xenomice|

---

US5231003A|1990-05-11|1993-07-27|Cambridge Bioscience Corporation|Monoclonal antibodies specific for toxin b of clostridium difficile|

---

US5545806A|1990-08-29|1996-08-13|Genpharm International, Inc.|Ransgenic non-human animals for producing heterologous antibodies|

---

US5932448A|1991-11-29|1999-08-03|Protein Design Labs., Inc.|Bispecific antibody heterodimers|

---

EP0690452A3|1994-06-28|1999-01-07|Advanced Micro Devices, Inc.|Electrically erasable memory and method of erasure|

---

US20100081792A1|2001-06-28|2010-04-01|Smithkline Beecham Corporation|Ligand|

---

US7235641B2|2003-12-22|2007-06-26|Micromet Ag|Bispecific antibodies|

---

KR101332994B1|2004-02-06|2013-11-26|메다렉스, 인코포레이티드|Antibodies against clostridium difficile toxins and uses thereof|

---

US7442778B2|2004-09-24|2008-10-28|Amgen Inc.|Modified Fc molecules|

---

US20090087478A1|2004-12-27|2009-04-02|Progenics Pharmaceuticals , Inc.|Orally Deliverable and Anti-Toxin Antibodies and Methods for Making and Using Them|

---

US9963510B2|2005-04-15|2018-05-08|Macrogenics, Inc.|Covalent diabodies and uses thereof|

---

US7612181B2|2005-08-19|2009-11-03|Abbott Laboratories|Dual variable domain immunoglobulin and uses thereof|

---

EP1820513A1|2006-02-15|2007-08-22|Trion Pharma Gmbh|Destruction of tumor cells expressing low to medium levels of tumor associated target antigens by trifunctional bispecific antibodies|

---

EP2033657A1|2007-09-04|2009-03-11|Trion Pharma Gmbh|Intraoperative trifunctional antibody application for prophylatic intraperitonal tumour cell dissemination|

---

CA2795953C|2010-04-15|2021-09-14|Progenics Pharmaceuticals, Inc.|Antibodies for the treatment of clostridium difficile-associated infection and disease|CA2795953C|2010-04-15|2021-09-14|Progenics Pharmaceuticals, Inc.|Antibodies for the treatment of clostridium difficile-associated infection and disease|

---

KR101907434B1|2010-09-03|2018-10-12|발네바 오스트리아 게엠베하|Isolated polypeptide of the Toxin A and Toxin B proteins of C. Difficile and uses thereof|

---

CN103917559B|2011-08-22|2018-01-12|肯杰尼公司|Clostridium difficile antibody|

---

LT2758432T|2011-09-16|2019-06-10|Ucb Biopharma Sprl|Neutralising antibodies to the major exotoxins tcda and tcdb of clostridium difficile|

---

AU2012349753A1|2011-12-08|2014-06-19|Novartis Ag|Clostridium difficile toxin-based vaccine|

---

CN102590515B|2012-01-13|2014-07-30|张春华|Clostridium difficile exotoxin A test kit and monoclonal antibodies therein|

---

CA2862483A1|2012-01-23|2013-08-01|Santalis Pharmaceuticals Inc.|Sandalwood oil and its uses related to clostridium infections|

---

KR20140130709A|2012-03-02|2014-11-11|리제너론 파마슈티칼스 인코포레이티드|Human antibodies to clostridium difficile toxins|

---

GB201206070D0|2012-04-04|2012-05-16|Health Prot Agency|Clostridium difficile antigens|

---

WO2014061783A1|2012-10-19|2014-04-24|株式会社イーベック|Human antibody specific to toxin produced from clostridium difficile, or antigen-binding fragment thereof|

---

CN105025926B|2012-11-28|2018-12-14|Cnj控股公司|For the antibody of clostridium difficile|

---

CA2893977A1|2012-12-21|2014-06-26|Seattle Genetics, Inc.|Anti-ntb-a antibodies and related compositions and methods|

---

WO2014144292A2|2013-03-15|2014-09-18|Sanofi Pasteur Biologics , Llc|Antibodies against clostridium difficile toxins and methods of using the same|

---

CA2910200A1|2013-04-22|2014-10-30|Board Of Regents Of The University Of Oklahoma|Clostridium difficile vaccine and methods of use|

---

EP2957570B1|2014-06-20|2019-04-17|Immunimed Inc.|Polyclonal antibodies against clostridium difficile and uses thereof|

---

US10513552B2|2014-06-20|2019-12-24|Immunimed Inc.|Use of polyclonal antibodies against clostridium difficile for treatment of inflammatory bowel disease|

---

WO2016156475A1|2015-03-31|2016-10-06|Vhsquared Limited|Polypeptide comprising an immunoglobulin chain variable domain which binds to clostridium difficile toxin b|

---

WO2016156474A1|2015-03-31|2016-10-06|Vhsquared Limited|Polypeptide comprising an immunoglobulin chain variable domain which binds to clostridium difficile toxin a|

---

US20180085458A1|2015-04-15|2018-03-29|Medimmune, Llc|Methods for treating clostridium difficile infection and associated disease|

---

EP3344276B1|2015-09-03|2020-04-22|The Board of Regents of the University of Oklahoma|Peptide inhibitors of clostridium difficile tcdb toxin|

---

BR112018069303A2|2016-03-24|2019-01-22|Paratek Pharm Innc|method for treating an infection|

---

US11185555B2|2016-04-11|2021-11-30|Noah James Harrison|Method to kill pathogenic microbes in a patient|

---

EP3448987A4|2016-04-29|2020-05-27|Voyager Therapeutics, Inc.|Compositions for the treatment of disease|

---

WO2018148537A1|2017-02-10|2018-08-16|Stc. Unm|Recombinant expression systems and products|

---

RU2020126721A3|2018-01-12|2022-02-14|

---

GB201807367D0|2018-05-04|2018-06-20|Univ Newcastle|Biomarker|

---

RU2694549C1|2018-08-16|2019-07-16|Федеральное государственное автономное учреждение "Национальный медицинский исследовательский центр здоровья детей" Министерства здравоохранения Российской Федерации |Method of conducting children with hirsperfly disease in perioperative period|

---

WO2021219786A1|2020-04-30|2021-11-04|Gottfried Himmler|Anti-toxin secretory iga2 preparation|

---

CN111499738A|2020-06-03|2020-08-07|郑州师范学院|Antibody for resisting clostridium difficile enterotoxin A|

法律状态:
2020-05-05| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2020-11-17| B07D| Technical examination (opinion) related to article 229 of industrial property law [chapter 7.4 patent gazette]|Free format text: DE ACORDO COM O ARTIGO 229-C DA LEI NO 10196/2001, QUE MODIFICOU A LEI NO 9279/96, A CONCESSAO DA PATENTE ESTA CONDICIONADA A ANUENCIA PREVIA DA ANVISA. CONSIDERANDO A APROVACAO DOS TERMOS DO PARECER NO 337/PGF/EA/2010, BEM COMO A PORTARIA INTERMINISTERIAL NO 1065 DE 24/05/2012, ENCAMINHA-SE O PRESENTE PEDIDO PARA AS PROVIDENCIAS CABIVEIS. |

---

2021-05-04| B07E| Notification of approval relating to section 229 industrial property law [chapter 7.5 patent gazette]|

---

2021-05-25| B06U| Preliminary requirement: requests with searches performed by other patent offices: procedure suspended [chapter 6.21 patent gazette]|

---

2021-10-19| B350| Update of information on the portal [chapter 15.35 patent gazette]|

---

2021-11-09| B07A| Application suspended after technical examination (opinion) [chapter 7.1 patent gazette]|

---

2022-03-08| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

优先权:

---

申请号 | 申请日 | 专利标题

---

US32450310P| true| 2010-04-15|2010-04-15|

---

US38166910P| true| 2010-09-10|2010-09-10|

---

PCT/US2011/032713|WO2011130650A2|2010-04-15|2011-04-15|Antibodies for the treatment of clostridium difficile-associated infection and disease|

---